from genomic data Gregg Thomas Indiana University Midwest Ecology and Evolution Conference 32815 Convergent evolution is observed at the phenotypic level Porcupine Rodentia Echidna ID: 1045742
Download Presentation The PPT/PDF document "Inferring molecular convergence" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
1. Inferring molecular convergence from genomic dataGregg ThomasIndiana UniversityMidwest Ecology and Evolution Conference3.28.15
2. Convergent evolution is observed at the phenotypic levelPorcupine(Rodentia)Echidna(Monotremata)Hedgehog(Erinaceomorpha)2
3. Predictable EvolutionIf phenotypic convergence can be attributed to specific molecular changes, it would suggest that evolution is to some extent predictableWe have very few examples…3
4. Phenotypic convergence can be attributed to molecular convergenceLysozyme (Kornegay et al, 1994)Prestin (Li et al 2010, Liu et al 2010)Foregut fermentersEcholocation4
5. Marine mammals provide a chance to study molecular convergence5
6. Convergent phenotypes of marine mammalsHydrodynamic body structure with reduced neck lengthSensory adaptationsSight in low light environmentsChanges in ear structure to accommodate hearing in high pressureChanges in respiratory and cardiac patterns depending on how long and deep the animal divesVariations in bone density based on dive depthInsulating blubber layer6
7. Marine mammal genome sequencing16,878 orthologous protein coding genes between the four marine mammals and ten other mammals5,900 orthologs which are present in all 4 marine mammals and their sister land mammals (cow, dog, elephant)7
8. Detecting molecular convergenceXXYYYX8Convergent substitutions inferred by ancestral sequence reconstructionConvergence can happen by chance – background convergence
9. Simulations suggest excess convergenceAlpacaCowDolphinKiller WhaleDogWalrusElephantManatee44 convergent substitutions9
10. Positively selected genes are also convergent10
11. Adaptive convergent genes are related to convergent phenotypesGeneFunctionAssociated phenotypeGCLC Glutathione metabolismAntioxidation during long divesS100a9 Calcium bindingBone formationMgp Calcium bindingBone formationSmpxInner ear formationSeparation of the auditory bulla from the skull in the inner earMyh7bCardiac muscle formationCardiovascular regulation during divingSerpinc1Blood coagulationLow flow rate of viscous blood particularly during diving11
12. Molecular convergence has been demonstratedPhenotypic convergence can be inferred on a genome wide scale at the molecular levelBut another comparison can be made…12
13. Marine mammal convergenceAlpacaCowDolphinKiller WhaleDogWalrusElephantManatee13
14. Land mammal convergenceAlpacaCowDolphinKiller WhaleDogWalrusElephantManatee14
15. Expectations for molecular convergence in land mammalsMost molecular convergence observed should be due to chanceThere should be less convergence than we found for marine mammals15
16. Convergent substitutions in land mammalsAlpacaCowDolphinKiller WhaleDogWalrusElephantManatee93 convergent substitutions16
17. Simulations suggest excess convergence even among land mammals93 convergent substitutions17AlpacaCowDolphinKiller WhaleDogWalrusElephantManatee
18. Land mammals have more convergence than marine mammals18AlpacaCowDolphinKiller WhaleDogWalrusElephantManatee
19. Positive selection comparable between marine and land mammalsMarine MammalsLand Mammals19
20. What we have learned from marine mammalsSome intriguing genes linking molecular and phenotypic convergenceSurprisingly, just as much molecular convergence among land mammals20
21. What we have learned from marine mammalsSome intriguing genes linking molecular and phenotypic convergenceSurprisingly, just as much molecular convergence among land mammalsSimulations do not fully account for background convergence21
22. Convergence can be inferred22Given a convergent phenotype, we can determine if molecular convergence has also occurred.
23. Echolocation convergence: what we know23Genes previously implicated for convergence of echolocation:PrestinKCNQ4Pcdh15Cdh23OtoferlinPjvkTmc1Figure from Parker et al, 2013
24. 24They identify 117 convergent genes between echolocating bats and dolphins, including significant convergence in sensory genesThis has already been attempted for echolocation
25. 25Problems with their approachIndirect measure of convergence: ΔSSLSIneffective control: Simulations
26. A better approach26EcholocatingEcholocatingNon-echolocatingXYYXXDirect measure of convergence: Convergent substitutionsEffective control: Empirical comparisons to other species
27. Detecting molecular convergence27Ancestral reconstruction of 6,400 one-to-one orthologs between 9 mammal speciesCounting of convergent substitutionsCheck for enrichment of sensory genes
28. Convergence is not excessive in echolocating species137228
29. Convergence is not excessive in echolocating species29
30. Convergence is not excessive in sensory genes30SLC45A2DFNB59PI4KBTCTN3TGFBIBCORRHOSIX6TCTN3BBS4TMC1RP1GTF3C2NECAP1RP2PAICSIFT172LGSNCLN5TTKLAMC1APCHPS4MKKSSLC26A5 DISP1 RPGRIP1 RPGRIP1LBBS2 RRH TYR IFT172DDX1 KIT
31. The consequences of using indirect measures of convergence31Genes identified as convergent by Parker et al using ΔSSLSGenes with convergent substitutions between all four bat lineages and dolphin
32. Echolocation conclusions32As with marine mammals, molecular convergence was observed in both species with and without phenotypic convergenceUse a direct measure of convergence when looking for convergenceUse an empirical null model to test whether observed convergence in a set of genomes or genes is significant
33. AcknowledgementsAdvisor:Matt HahnColleagues:James PeaseSimo ZhangFabio MendesRafael GuerreroJeff AdrionBen RosenzweigMarine Mammal collaborators:Andy FooteYue LiuTomas VinarKim WorleyEcholocation collaborators:George ZhangZhengting Zou33GCMS Training Grant
34. 34
35. Supplemental slides35
36. Detecting molecular convergenceAncestral sequence reconstruction36
37. Detecting molecular convergence37ATGCATATGAATATGAATATGAATATGCATATGAATConvergent substitutionConvergence can happen by chance – background convergence
38. Positive selectionAlpacaCowDolphinKiller WhaleDogWalrusElephantManateeGenes that undergo adaptive changes may exhibit accelerated molecular evolution
39. Genes can have more than one convergent site= convergent substitution39
40. Genes with multiple convergent sites are more prevalent in land mammals40
41. Marine mammals – all pairs41
42. Prestin satisfies all criteria for being convergent between bats and dolphins42Prestin is a membrane motor protein that drives the electromotility of mammalian outer hair cells in the earConvergent substitutions between echolocating bats and dolphins have been observed previouslyRecent work also shows that these convergent changes are actually functional
43. Background convergence can be predicted43
44. Convergence is not excessive in echolocating species44
45. Convergence is not excessive in echolocating species – even among sensory genes45