What organelle makes proteins Where are these organelles found How does the information from DNA get to those organelles Protein Synthesis Overview The information in DNA is used to make ID: 1042695
Download Presentation The PPT/PDF document "Protein Synthesis Where is DNA found?" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
1. Protein Synthesis
2. Where is DNA found? What organelle makes proteins?Where are these organelles found?How does the information from DNA get to those organelles?
3. Protein Synthesis OverviewThe information in DNA is used to make proteins. These proteins are used for a variety of purposes within the body. (do you remember why our body needs protein?)
4. However there is a problem. The DNA never leaves the nucleus. But the ribosomes, (remember? they make proteins) are in the cytoplasm. How can the information get from the nucleus to the ribosomes in the cytoplasm?The solution is that the cell makes a temporary copy of the DNA. The temporary copy is called RNA.
5. RNA RNA stands for ribonucleic acid Found in both the nucleus and cytoplasm Role: create a temporary copy of the instructions in DNA to send to the ribosome
6. RNA Structure Single stranded Like DNA, RNA is made of nucleotides RNA nucleotides consist of:1. Phosphate (acid)2. Ribose (sugar)3. Nitrogenous base
7. Nitrogen Bases1. Adenine (A)2. Uracil (U) – replaces thymine3. Cytosine (C) 4. Guanine (G)
8. 3 Types of RNA1. mRNA 2. rRNA 3. tRNA
9. Messenger RNA (mRNA)Acts as a messenger, carries a copy of the directions from the DNA in the nucleus to the ribosome in the cytoplasm
10. 2. Ribosomal RNA (rRNA)Part of the ribosomeThe ribosome is made up of proteins plus rRNA.
11. 3. Transfer RNA (tRNA)Anti-codonRemember:Ribosomes make proteins, which are made of amino acids tRNA brings those amino acids to the ribosome to be assembled into the correct order
12.
13. Draw DNA & RNA with their 4 bases in your notebook.
14. DNA and RNADifferencesSimilaritiesDifferences
15. The Central Dogma of Biologyhttp://ed.ted.com/lessons/dna-the-book-of-you-joe-hanson#watch
16. Protein Synthesis2 Steps:1. Transcription2. TranslationStated Clearly Video
17.
18. Step 1: TranscriptionTranscription is the first step in protein synthesis. Purpose: to make RNA, a copy of the information in DNA. Location: in the nucleus.To get started you need:DNAFree RNA nucleotidesRNA polymerase
19.
20. Step 1: InitiationRNA polymerase attaches to a promoter region of DNA Promoter= specific sequence of DNA
21. Step 2: ElongationRNA polymerase opens the DNA helix. It makes a little bubble. One strand will act as a template.RNA polymerase moves down the DNA molecule attaching complementary RNA nucleotides as it goes.
22. Step 2: ElongationEverything is the same as DNA replication except:The DNA A pairs with RNA U
23. Match the DNA bases to the RNA basesDNAATGACTCRNA
24. Step 3: TerminationTranscription stops when RNA polymerase reaches the terminator region of DNA. Terminator signals end of the gene.
25. Step 3: TerminationRNA polymerase then detaches from the DNA mRNA sent out of nucleus to cytoplasm after mRNA editingStated Clearly VideoAnimationTranscription Video
26. Summarize Transcription in your notebooks (bullet points)Check your summary with a partner when finished.
27.
28. mRNA EditingOccurs directly after Transcription Aka RNA splicing- essentially cutting and pasting of the mRNADNA & RNA contain portions called introns and exons
29. EXONS: pieces of DNA that are expressed- used to make proteins these are kept in mRNAINTRONS: Not used to make proteins: Removed from mRNAmRNA Editing
30. mRNA EditingFinally:A cap and a tail are added to the ends of the mRNAPurpose:Facilitates export out of nucleusProtects from attack by enzymesHelps ribosomes bind to it
31. Answer these questions in your notebook:What are introns and exons?Introns are pieces of DNA that do not code for proteins. Exons code for proteinsAre introns or exons important for protein synthesis?Exons are necessary for protein synthesis- exons give us instructions to make proteinsWhy do we edit the mRNA after copying DNA?We edit out the introns because we only want the parts of the DNA that tell us how to make proteins. For protein synthesis, the introns are useless.
32.
33. Step 2: TranslationLocation: In ribosomes in the cytoplasmPurpose: To make proteinsHow It Works:The mRNA (copy of the DNA info) created in the nucleus moves to the ribosome in the cytoplasmRibosome reads the mRNA which tells the ribosome which amino acids to put together to make a protein
34. How do we read mRNA?:mRNA contains codons- every 3 bases on mRNA = 1 codon These codons code for (give instructions for) a certain amino acidThere are multiple codons for 1 amino acid tRNA reads these codons and carries the necessary amino acid to the ribosome
35. Translation- Step 1. InitiationInitiation 2 ribosomal subunits attach to the mRNA There is a START codon on mRNA which tells the ribosome to start bringing amino acids to it.
36. Large Ribosomal Subunit (rRNA)E SiteA SiteP SiteSmall Ribosomal Subunit (rRNA)tRNAU A CTranslation MechanismMETtRNAU A UAUGACCAUAGCAUGAAUGAUCAUGUISOMETAUGACCAUAGCAAUGAUGAUCAUGUtRNAU A UtRNAU A CtRNAG G GPROmRNAThis process continues until a stop codon is reached, at which point the mRNA strand, tRNA units, and rRNA subunits all are released.Start Codon (Methionine)
37. Step 2: ElongationA. Codon recognition occurs mRNA= has codontRNa = has anti-codon which matches the mRNA codon tRNA with anti-codon that matches the mRNA START codon attaches to ribosome, bringing an amino acid with it Another tRNA attaches to ribosome
38. Step 2: ElongationB. Peptide Bond FormationRibosome forms a peptide bond between the amino acids from tRNA to start a chain Old tRNA leaves ribosome while new one attaches- continues until STOP codon reached
39.
40.
41. Step 3: Termination STOP codon is reached STOP codon tells tRNA to stop binding to ribosomeRibosome pulls away from mRNA Translation complete- ending with a complete protein Translation Animation
42. The new protein is released. The string of amino acids fold-up into the shape of the protein. Protein sent to Golgi for packaging and shippingPost-Translation . . .
43. Summarize Translation in your notebooks (bullet points)Check your summary with a partner when finished.
44.
45.
46.
47.
48. Practice Creating ProteinsUsing the chart on your guide, find the amino acid sequence created from the following strands of DNA:
49. Genetic MutationsMutation = Changes in the DNA sequenceMutagenesis – the production of mutationsMutagen – something that causes mutationsA physical or chemical agent such as x-rays, high-energy radiation, chemicalsSpontaneous – occur during replication or other similar processes http://ed.ted.com/lessons/the-twisting-tale-of-dna-judith-hauck#watch Genetic mutations
50. Gene Mutation
51. Two types of MutationsGene mutations – within a single genePoint mutation (results from substitutions)Ex: TAC changes to AACGenetic disorder ex: Sickle cell anemia, Cystic FibrosisSilent mutation – diff codon, but same amino acidFrameshift mutation (results from insertions/deletions)Ex: insert a T after first T so TAC – GCC changes to TTA – CGC - C