Caroline Goutte The Power of a Genetic Model System: - PowerPoint Presentation

1. Caroline GoutteThe Power of a Genetic Model System:Using Soil Nematodes to Discover Genes Involved in Human Alzheimer’s Disease

2. I. The Worm as a Model SystemII. The Power of Genetic AnalysisIII. An Example:Research Project: Genetic Analysis of Cell Communication Processes in C. elegans Leads to the Identification of Genes Important for Human Alzheimer’s DiseaseOverview

3. Biology at the cellular/molecular levelIn order to understand these molecules and processes:Use a Model SystemSimplicityExperimentationAll species share the same fundamental molecular components and molecular processes

4. Model Systems for studying fundamental questions of biology at the genetic levelEscherichia coli and bacteriophage(bacteria and their viruses)Saccharomyces cerevisiae (baker’s yeast)Caenorhabditis elegans (nematode worm)Drosophila melanogaster (fruit fly)Mus musculus (mouse)All amenable to traditional and molecular genetic analysis All have attracted a critical mass of investigatorsAll had their genomes fully sequenced by 2002

5. Part of the success of molecular genetics was due to the use of extremely simple organisms which could be handled in large numbers: bacteria and bacterial viruses. The processes of genetic replication and transcription, of genetic recombination and mutagenesis, and the synthesis of enzymes could be studied there in their most elementary form, and, having once been discovered, their applicability to the higher forms of life could be tested afterwards. We should like to attack the problem of cellular development in a similar fashion, choosing the simplest possible differentiated organism and subjecting it to the analytical methods of microbial genetics. Thus we want a multicelluar organism which has a short life cycle, can be easily cultivated, and is small enough to be handled in large numbers, like a micro-organism. It should have relatively few cells, so that exhaustive studies of lineage and patterns can be made, and should be amenable to genetic analysis.We think we have a good candidate in the form of a small nematode worm…Although the total number of cells is only about a thousand, the organism is differentiated and has an epidermis, intestine, excretory system, nerve and muscle cells.Sydney Brenner early 1960s“…nearly all the ‘classical’ problems of molecular biology have either been solved or will be solved in the next decade…the future of molecular biology lies in the extension of research to other areas of biology, notably development and the nervous system.”

6. Caenorhabditis elegans introduced in 1963 by Sydney Brenner A new model system specifically chosen for its simplicityGoal: the genetic dissection of development and behaviorSuccess: Today’s “Worm Community” ~15,000 scientists3 Nobel Prizes (‘02, ‘06, ‘09)Features:Size: 1 mm in lengthGeneration time: 3 daysLife Span: 2-3 weeks~300 progeny per generationCultivate in lab on petri dishesTransparentOnly 959 cells!

7. B. Goldstein, UNC

8. 3 Unique Tools that made C. elegans a powerful model system:Complete Cell MapsComplete Cell Lineages Complete Genome Sequence

9. Tool #1: Detailed Map of Worm Anatomy single-cell resolution (completed by John White, 1986)959 somatic cells (neurons, muscles, intestinal cells, epidermal cells, etc.)

10. Tool #2: Cell Lineage Maps Each cell’s lineage can be traced back to the fertilized egg (completed by John Sulston, 1983)

11. 1 sec = 1 hr.B. Goldstein, UNC

12. fertilized eggtimeABP1ABaABpEMSP2EMSP2ABpABa

13. fertilized egg959 somatic cells in adult hermaphrodite

14.

15. December 11, 1998Tool #3: Complete Genome Sequence(completed by C. elegans Sequencing Consortium, 1998) Model SystemGenome sequencecompletedGenome Size (Mb) (x 106)Number of genesGene Density (Kilobases per gene)S. cerevisiae (yeast)199712 60002C. elegans1998100~20,0005D. melanogaster (fruit fly)2000140 ~14,00010M. musculus (mouse)20022500~25,000100H. sapiens20013000~25,000120

16. Genes encode proteins that drive biological processes Genetic AnalysisWe can learn about specific gene function by studying the effect of gene mutations: normal gene normal functiondefective gene aberrant function

17. Genetic Analysis: Two different approachesdisrupt gene Xnormal gene normal functiondefective gene aberrant functiondiscover the function of gene Xnormal gene normal functiondefective gene aberrant functionfind disrupted function Xdiscover genesresponsible for function XIII

18. Genetic Analysis: Two different approachesdisrupt gene Xnormal gene normal functiondefective gene aberrant functiondiscover the function of gene XUse targeted mutagenesis or RNAi Observe effect on phenotype* Adapt to High Throughput versionStart with gene of interest: What is the function of gene x ?I

19. normal gene normal functiondefective gene aberrant functionfind disrupted function Xdiscover genesresponsible for function XStart with process of interest: What gene products are involved in process x? The Mutant Hunt: 1) predict mutant phenotype 2) perform random mutagenesis 3) collect desired phenotype 4) identify responsible genesII

20. Genetic Analysis: Two different approachesdisrupt gene Xnormal gene normal functiondefective gene aberrant functiondiscover the function of gene Xnormal gene normal functiondefective gene aberrant functionfind disrupted function Xdiscover genesresponsible for function XIII

21. An example Research Question: What are the molecules that mediate cell communication?

22. pharynxmouth

23. from Z.F. Altun & D.H. Hall and from S. Mango

24. ?

25. anterior pharynxposteriorpharynxmouth

26. ABp

27. ABp

28. ABp

29. ABp

30. cell communicationHow?

31. cell communicationHow?normal gene normal functiondefective gene aberrant functionfind disrupted Cell communicationdiscover genesresponsible for Cell communicationWhat genes are required?

32. 1) Random mutagenesis of C. elegans genome (20,000 genes)2) Search through thousands of worms3) Find mutants that have aberrant pharynx morphology Genetic Mutant Screen

33. wild type:mutants:aph-1-aph-2-glp-1- lag-1-lag-2-pen-2-sel-12- sup-17-The products normally encoded by these genes are responsible for mediating the cell communication eventWhat are these products? …turn to the gene sequence for clues

34. What type of protein is encoded by each gene?Identify the gene in genomeStudy DNA sequence to predict gene productCompare to gene databases glp-1

35. DNA sequence of the glp-1 geneatgcgagttcttctaattttactcgcgttttttgcgccaatcgccagtcaacttatgggtggagaatgcggaagggaaggtgcttgctccgtcaatggaaaatgctataatggaaaactgattgagacatactggtgccgttgcaaaaaaggattcggaggtgctttctgtgaacgtgaatgcgatttggattgtaaacgaggcgagaagtgcatctacgatgtttatggtgaaaatccgacgtgtatctgtcaagattgcgaagacgagactcctccaacagaacgtactcaaaaaggctgtgaagaaggctatggaggtcctgactgcaaaactcctctattttcgggagtaaatccatgcgattcggatccttgcaacaacggactctgctatccattctatggtggatttcagtgcatatgcaacaatggatatggaggatcgtattgtgaagaaggaatcgatcattgtgctcaaaatgaatgcgcagaaggttcaacgtgtgtcaatagtgtatacaactattactgtgattgcccaattggaaaatccggtcgatattgtgaacgaactgaatgtgctttgatgggaaacatttgcaatcatggaagatgtattccgaacagagatgaagacaagaacttcagatgtgtatgcgactcgggatacgagggagaattttgcaataaggataaaaacgaatgcctcatcgaagaaacgtgtgttaacaactctacatgtttcaatttgcacggtgattttacttgtacctgtaaacctggatacgctggaaagtattgcgaggaggctatcgacatgtgcaaggattacgtttgccaaaatgatggatactgtgcccatgactcgaatcagatgccaatttgttattgcgaacaaggattcactggacaacgatgtgagattgagtgtccttcaggattcgggggaattcattgtgatcttccactacagagaccacactgctctcggagcaatggaacgtgttacaacgatggaagatgtataaatggtttctgtgtctgtgaacctgattatattggagatcgatgtgagattaataggaaagatttcaagPredict Protein sequence of the glp-1 gene productMRVLLILLAF FAPIASQLMG GECGREGACS VNGKCYNGKL IETYWCRCKK GFGGAFCERE CDLDCKRGEK CIYDVYGENPTCICQDCEDE TPPTERTQKG CEEGYGGPDC KTPLFSGVNP CDSDPCNNGL CYPFYGGFQC ICNNGYGGSY CEEGIDHCAQNECAEGSTCV NSVYNYYCDC PIGKSGRYCE RTECALMGNI CNHGRCIPNR DEDKNFRCVC DSGYEGEFCN KDKNECLIEETCVNNSTCFN LHGDFTCTCK PGYAGKYCEE AIDMCKDYVC QNDGYCAHDS NQMPICYCEQ GFTGQRCEIE CPSGFGGIHCDLPLQRPHCS RSNGTCYNDG RCINGFCVCE

36. glp-1 gene encodes a cell surface receptor proteinExtracellularIntracellularcell membrane

37. glp-1 gene encodes a cell surface receptor proteinExtracellularIntracellularC.elegans2 Notch genescell membraneEvolutionarily conserved Family of “Notch” ReceptorsMammals4 Notch genesJ. Kimble et al., U. Wisconsin, 1987J. Priess et al., MRC England, 1987I. Greenwald et al., Columbia U., 1989

38. Notch Receptor Proteinon cell surfacereceives a signalsignaling cell

39. signaling cellNotch Receptor Proteinon cell surfacereceives a signal

40. wild type:mutants:aph-1-aph-2-glp-1- lag-1-lag-2-pen-2-sel-12- sup-17-The products normally encoded by these genes are responsible for mediating the cell communication eventWhat are these products? …turn to the gene sequence for clues

41. signaling cellresponding cellNotchtarget gene regulationCleavage I Cleavage IIWhat types of proteins do these genes encode, and what do they do?lag-1sel-12sup-17LAG-2more genes:aph-1 and aph-2

42. aph-1 is predicted to encode a 7-passtrans-membrane proteinLook for aph-1-like genes in genomic databases: Eureka! aph-1 is a conserved gene(Human and Drosophila genes now receive a name: “Aph1” !)

43. aph-2 is predicted to encode a large extracellular proteinthat is anchored to the membraneLook for aph-2-like genes in genomic databases: Eureka! aph-2 is a conserved genemembranespanningglycosylations

44. signaling cellresponding cellNotchtarget gene regulationCleavage I Cleavage IIWhat is the molecular role of APH-1 and APH-2 ?lag-1sel-12sup-17LAG-2APH-2APH-1?

45. And now for something completely different….(or so we thought)Studies of Alzheimer’s disease…

46. Alzheimer’s DiseaseNeurodegenerative dementiaAmyloid Plaques in brain tissueAbnormal accumulation of amyloid b protein (Ab ) Small % of AD patients have early onset ADbecause they inherited an aberrant gene that increases the amount of aggregating Ab What are these genes?1) APP (amyloid precursor protein)2) Presenilincan these genes lead us to understand the molecular mechanisms that lead to AD?

47. APP encodes a small membrane-anchored proteinthat gets cleaved to release A proteinPresenilin is a membrane-bound protein that cleaves APPpresenilinaberrant cleavage yields neurotoxic Aamyloid plaques inAlzheimer’s diseaseamyloid precursor proteinAPPCleavage ICleavage II ADrug design?How does it work?presenilin = human version of sel-12, (the C. elegans protein that cleaves Notch Receptor !)Levitan and Greenwald, 1995

48. How does presenilin cleave APP? Who are its collaborators? presenilinNicastrinProtein biochemistry using presenilin as fishing bait: discover an interacting protein: “Nicastrin”Yu et al., 2000 presenilin?200 kD97 kD55 kD36 kD21 kDimmunepre-immune12PS1-FLPS1-NTFPS1-CTFabAPPCleavage IApresenilinNicastrinCleavage II

49. What type of protein is Nicastrin? Determine gene sequenceLook in databases for similar genesInstant Lessons: human Nicastrin must function in Notch-mediated cell communicationAPH-2’s molecular role in cell communicationis clearer: APH-2 forms a complex with with sel-12 human Nicastrin = C. elegans APH-2 !

50. signaling cellresponding cellNotchtarget gene regulationCleavage I Cleavage IIWhat is the molecular role of APH-1 and APH-2 ?lag-1sel-12sup-17LAG-2APH-2APH-1?APH-2

51. signaling cellresponding cellNotchtarget gene regulationCleavage I Cleavage IIAPH-1 and APH-2 interact with presenilin/sel-12 to form a molecular machine that cleaves cell surface proteins (Notch Receptor, APP, etc.)lag-1sel-12sup-17APH-2APH-1

52. Model of-Secretase Quartetsel-12APH-2APH-1

53. Model of-Secretase QuartetPresenilinSEL-12APH-1APH-2 Nicas.PEN-2Alzheimer’s Disease study of inherited form Presenilin/SEL-12 (Sherington et al.’95; Levy-Lahad et al., ’95; Rogaev et al., ‘95) protein biochemistry Nicastrin/APH-2 (Yu et al., ’00)Cell Communicationvia Notch Receptor C. elegans model system hunt for mutants sel-12 (Levitan et al., ‘95) aph-2 (Goutte et al., ‘00) aph-1 (Goutte et al., ’02; Francis et al., ‘02) pen-2 (Francis et al., ’02)

54. Useful Websites:http://www.wormclassroom.org designed for teachers (high school - college) great introduction, pictures and movies, and computer-based exercises, http://www.wormbase.org gateway to all C.elegans reseach tools searchable - by author, by cell, by gene, etc.http://elegans.swmed.edu more simple gateway - good introductions to worms http://www.wormatlas.org beautiful images and explanations of all the worm cells, tissues, major anatomical descriptionshttp://www.bio.unc.edu/faculty/goldstein/lab/movies.html great movies (single-cell divisions as well as whole worm)

55. 1 sec = 1 hr.

56.

57.

58. An example: where is the “HSN neuron”8000 prints from serial section electron micrographs

59. HSN in adultLineage of the HSN cell