HAPPY MONDAY 3/13 Review for - PowerPoint Presentation

1. HAPPY MONDAY 3/13Review for Inheritance Test tomorrow!Study session after school Study guide answers will be posted @ 6:00pm tonightDon’t forget: Trihybrid Extra Credit and Karyotype Extra Credit due tomorrow as well

2. HAPPY TUESDAY 3/14Turn in any Extra Credit to green boxClear desks for Inheritance TestExtra Credit last 10 minutes of classTurn in test to green box when finished

3. HAPPY WEDNESDAY 3/15Give your brains a rest!DNA structure coloring sheet and analysis questionsAnswer the analysis questions in your notebook or on the back of the worksheetTextbook reading over the storing of genetic information and the structure and replication of DNADue this FRIDAY, March 17Friendly reminder: I will also be stamping Pedigree Analysis Packet and Meiosis Review sheet FRIDAY

4. HAPPY THURSDAY 3/16Take out notebook and prepare for “Gene Expression Lecture Day 1”Reminder: I will be checking DNA coloring sheet/DNA Structure and Replication reading guides x2 tomorrow (Friday 3/17)Also checking “Pedigree Analysis” and “Meiosis Review”

5. Gene ExpressionHow do genotypes become phenotypes?23 from mom23 from dad

6. Chromosome: Structure found in the nucleus of all* cells Made of DNA coiled around histone proteins, compactedDNA: Double helix shapeStores genetic “gene” information Self-replicates to produce 2 exact copies of itselfGene:A segment of DNA that serves as a code for a specific phenotype Gene for Type A Blood

7. GenotypePhenotypeinheritPropose how this occurs. What other factors might be included “within” the blue arrow? How do you go from alleles (A, a) to an actual phenotype that is noticeable?

8. DeoxyriboNucleic AcidAntiparallel strands (gene is 5’ 3’)Monomers = nucleotidesAdenine, Thymine, Cytosine, Guanine1 nucleotide = 3 parts Deoxyribose sugarPhosphateBase Uses complimentary base pairing rules A  T and C  G5’ CGTGGTTAAATCT 3’

9. The Central Dogma of BiologyDNA RNA Protein

10. DNA RNA ProteinTranscriptionTranslationThe Central DogmaReplication

11. DNA ReplicationDNA is copied accurately to preserve an organism’s genotypeOccurs before cell division so each chromosome has 2 copies to givemeiosis (cell division for gametes) mitosis (cell division for growth)Takes place in the nucleusEnzymes used in process:Helicase - Unwinds double helixDNA Polymerase - Creates new strand

12. DNA ReplicationNew DNA strands are formed based off original DNA sequence

13. DNA Replication5’ CGTGGTTAAATCT3’ GCACCAATTTAGA“Template Strand”3’  5’GAGTCCTGTCATAAAATG 3’CTCAGGACAGTATTTTAC 5’Let’s model DNA Replication!“Gene”5’  3’

14. What’s next?After DNA Replication, there is enough DNA make 2 new cells… and then again, and again until the organism stops performing cell division (i.e., never, really). Once a new cell is made, it can begin to use the DNA to create phenotypes.We call this next part Gene Expression, or the production of a phenotype given information from the genotype (“gene” = segments of DNA) and it can be divided into 2 steps: Transcription and Translation.

15. HAPPY FRIDAY 3/17Take out homework for stampsButterfly Stamps“Pedigree Analysis” PacketMeiosis ReviewNew StampDNA Structure Coloring SheetReading Guide X 2While I am stamping your work, please complete the DNA Replication Processing ActivityIn your notebook do the following:Cut out sister chromatid, DNA strand, and replication stepsDecide in which order to place the steps of replication and number themGlue in sister chromatids and DNA strand, correctly indicate (with arrows) where each step takes place (if applicable)

16. TranscriptionProduces a RiboNucleic Acid (single) strand using a DNA templateDNA is “read” from 3’  5’ (“template” strand)Transcription enzyme = RNA PolymeraseTakes place in the nucleusIn gene expression, mRNA is madeBase pair rules: C  GG  CT  AA  U

17. Let’s Transcribe!Gene 5’ TCATGCAGAGGAGATTAA 3’ Template 3’ AGTACGTCTCCTCTAATT 5’mRNA 5’ 3’Gene 5’ GATCAGGGAGACTTAGCA 3’ Template 3’ CTAGTCCCTCTGAATCGT 5’mRNA 5’ 3’

18. TranslationProduces an amino acid sequence using mRNA as a template mRNA is “read” from 5’  3’ in triplets (“codons”)Codons code for amino acidsStart codon is AUG but stop codon variesEnzyme* that does this is called tRNATakes place in cytoplasm at a ribosomeAfter folding of polypeptide, a protein is formed!

19. The Genetic CodeExamples:AUG is Met (start)ACC is ThrAGA is Arg!UAA is StopUAG is StopUGA is Stop

20. Use the Genetic Code to figure out what amino acids are assembled based on mRNA strandAlanineThreonineGlutamateLeucineArginineSerineStop!

21. TranslationGene 5’ GATCATGCGTCTCCTCTAATT 3’TemplatemRNAAmino Acids

22. TranslationGene 5’ 3’Template 3’ CTCATACGGACAGTATTTTAC 5’mRNAAmino Acids

23. Once the amino acid sequence is complete, it folds into a 3D “glob” = a protein! Proteins do all of our cellular work, so they create phenotypes.Discuss with a neighbor:How do you get from genotype to phenotype?

24. Your TaskGene Expression Practice WorksheetCompare to key when finished to see if you have the skills!Homework due FridaySnorks

25. Discuss with your neighbors:Where does DNA Replication take place?Where does Transcription take place?What does Transcription produce?Where does Translation take place?What does Translation produce?The Genetic Code is used to figure out what amino acids are assembled based on the strand created from the strand

26. What is the deal with 5’ and 3’?