RENATALol 34 No 4 December 2003891 - PDF document

RENATALol 34 No. 4 December 2003891 EALTH up in the reference center for hemostatic disor-The present study reports the cost-effective-International Hemophilia Training Center, Fac-University, Bangkok, Thailand.MATERIALS AND METHODSfamilies with hemophilia were included. Therewere 180 hemophilia A carriers and 29 hemophiliaof laboratory confirmation. They included femalesfemales with an obligate carrier mother, with oneof hemophilia alone. The possible carriers re-Additional genotypic analysis was per-the reproductive life. They included mothers, sis-tients. The prenatal diagnosis was offered to fe-risked having offspring with a severe or moder-ate degree of hemophilia. The prenatal diagnosis12 weeks of gestation and/or fetal blood sampling Two blood samples, taken one week apart,gestion of oral contraceptives or pregnancy, intoringe technique. The samples were immediatelyC before testing. The levels of fac-tor VIII clotting activity (FVIII:C) and vonillebrand factor antigen (vWF:Ag) were deter-mined in females at risk for being hemophilia Afor being hemophilia B carriers. The cut-off levelor B carriers was less than 50%. Additionally,the cut-off ratio of FVIII:C to vWF:Ag for deter-mining hemophilia A carriers was 0.6 (Pintadit The levels of FVIII:C and FIX:C were deter-mined by the one-stage method based on the par-Macpherson, 1962; Pitney, 1975) wi

th factor VIIIor IX deficient plasma as substrate. The hemophiliacDNA was extracted from 10 ml of EDTA, 1977). The polymor-phisms associated with the factor VIII and IXI for the factor VIIII for the factor IX gene. Amplifi-cation of factor VIII and IX sequences for analy-and Gitschier, 1990) is briefly described. Usingthe published primers (Table 1) 250 ng of genomicM dNTPs (Pharmacia) and 1 unit Taq poly- RENATALol 34 No. 4 December 2003893 cording to the manufacturerÕs instruction and thenPrenatal diagnosis for hemophiliathe DNA amplification for the X and/or Y chro--CTCTGATGGTTACCTTGCTCATreaction volume consisting of 10 mM Tris HClpH 8.3, 50 mM KCl, 1.5 mM MgClof each primer and 1 unit Taq polymerase(Perkin-Elmer). Following an initial denatur-cycles. The approximate product sizes are 500bp from the X and 350 bp from the Y chromo-was performed at 10-12 week gestation. Thebefore being resuspended in 0.15 mM NaCl,0.25 mM EDTA, 0.5% sodium dodecyl sulfate.and phenol/chloroform extraction. Then, thestituted in water. Alternatively, a small piece ofchorionic villi was washed by TE buffer (10mM Tris-HCl, 1 mM EDTA pH 7.9) and boiled22 weeks of gestation. The purity of the fetalblood was checked by staining with Amidoblack. The actual amount of 0.5 ml fetal bloodsodium citrate. The levels of FVIII:C or FIX:Cthe levels of fetal FVIII:C or FIX:C were cor-wa

s determined by staining with Amido black(Betke and Sanguansermsri, 1972). A 30-minutecompletely air-dried blood smear was fixed in80% ethyl alcohol. The slide was stained for 3minutes by Amido black dissolved in 80% ethylquently, the slide was rinsed in tap water for 1minute and air-dried. Red cells containing HbFRESULTSamong 131 females with possible carriers. Thenumber of females at risk for hemophilia A andB carriers was 117 and 14, respectively. The re-as carriers (45 hemophilia A carriers and 4 hemo-diagnosed as normal. However, 17 females (13%)were undetermined as carriers or normal. Addi-46 families (41 hemophilia A, 5 hemophilia B)The polymorphisms associated with factor VIIIcarriers is shown in Table 2. The informative rate EALTH was 56% (28/50) while the remainder was non-informative. The genotypic analysis was helpfulin the additional diagnosis of 4 hemophilia A car-riers and 1 hemophilia B carrier. The genotypicobligate carriers. The informative rate was 66%shown in Table 3. The fetal sex was simulta-philia by an informative genetic marker. In caseMoreover, one female (No.3), who possessed afemale offspring with a carrier state, requested tomosomes to exclude TurnerÕs syndrome of 45,XO. The prenatal diagnosis of a hemophilia car-rier status for the female offspring was not al-ways required. Unfortunately, one female (No.5),her male fetus, was

affected by hemophilia. Theresis for females and family members for determin-informative markers is shown in Table 4. Addi-tionally, the cost of prenatal diagnosis was calcu-Primers used for the study of polymorphisms associated with factor VIII and IX genes.SiteRestriction enzymePrimersReferenceAAAAGCTTTAAATGGTCTAGGC 3TTCGAATTCTGAAATTATCTTGTTC 3 GATAGAGAAACTGGAAGTAGACCC 3TTAGGTCTTTCACAGAGTAGATTT 3 CTCGTTGTGCACATGTACCC 3 CAATACCACCCTATCCTTCGTCGA 3ACTGCCCATTCTCTTCACTTGT 3 CTGTCAAATCATGTAATCAAAATTTCG 3ACAGGCACCTGCCATCACTT 3AGATTTCAAGCTACCAACAT 3 GGGACCACTGTGGTATAATGTGG 3 CTGGAGGATAGATGTCTCTATCTG 3HemophiliaHemophiliaNormalUndetermined(%)A carrierB carrierNon-informative genotypic analysis1122(44)Same phenotypic and genotypic analysis1517023(46)Normal phenotypic analysis but diagnosed31004(8)Undetermined phenotypic analysis but10001(2) Status of females RENATALol 34 No. 4 December 2003895 No. DateType ofRisk toChorionicFetalSexcarrier hemophilia villiblooddeterminationsamplingsamplingMethodResult 130 Sep 1994ObligateA 226 Apr 1996ProvenA-FVIII:C 73%Normal male 322 Apr 1997ProvenA17 Feb 1998ProvenA 530 Mar 1998ProvenA18 Jan 2000ProvenA 718 Apr 2000ProvenA 818 Feb 2000ProvenA--Female 931 Aug 2000ObligateB-XYRFLP 1028 Nov 2000ObligateA-XYFVIII: 67%Normal male20 Nov 2001ObligateA3 Dec 2002ProvenAprenatal diagnosis of hemophilia, and unfortunatel

y the male offspring was affected with hemophilia, the status of normal or female was not determined postnatally.Cost per caseTotal costBahtUS$BahtUS$Hemophilia A carrier1174001046,8001,170Hemophilia B carrier1420052,80070Hemophilia A family413,00075123,0003,075Hemophilia B family56,00015030,000750Female at risk123,0007536,000900otal238,600 5,965patient with hemophilia A.AgeBleedingNumber of utilized(years)episode/yearLC/yearBahtUS$1-101040200,0005,0001-1510100200,0006,25015-30575562,50014,062.5otal 1,012,500 25,312.5 Determinationof hemophilia EALTH lated. The total cost of carrier detection and pre-government hospitals was US$ 5,965. The esti-shown in Table 5. The replacement therapy wasBlood Center, Thai Red Cross Society. The costhemophilia A was 4 times that for carrier detec-tion and prenatal diagnosis. Actually, there werethree pregnancies with affected fetuses with he-mophilia A among 209 females. Therefore, theThe effective prevention of hemophilia, es-semia and hemoglobinopathy traits is 40% of theThai population. The prenatal diagnosis for fe-males at risk of having offspring with thalassemiapitals in Thailand. Therefore, these facilities cantesting. The cost of assaying FVIII:C, FIX:C andof reagents such as factor VIII deficient plasma,agents. Factor VIII deficient and factor IX defi-and without inhibitor. Normal plasma can be pre-included equ

ally. The ELISA for vWF:Ag can beprepared by an Ôin houseÕ method. The rabbitfrom pharmaceutical companies. The Ôin-houseÕlished for service at an affordable price for mostPhenotypic analysis for determining the car-rier status of hemophilia A and B is limited. Twosubsequent blood testings are required. Approxi-1996; Rurgkhum , 2002). The addition ofvWF:Ag to calculate the ratio of FVIII:C andbetween carrier and non-carrier status. Ten tonosed as carriers or normal. A more accurate toolof genotypic analysis is required. Genotypicdetermined carriers during reproductive life only.analysis is an effective procedure with an accu-racy rate of greater than 99% if there is an infor-mative marker. The allelic frequencies of DNApolymorphisms associated with factor VIII andIX genes in the Thai population are lower than, 2000). Therefore, the genotypicover, an affected individual with hemophilia mustbe included in the study. The important femalesDNA polymorphism. Then, the informativeof hemophilia in that family. DNA polymorphismphilia since the male fetus is mainly affected. Sex RENATALol 34 No. 4 December 2003897 some. Although the chance of a female hemo-philiac with TurnerÕs syndrome is rare, it is still apossible risk. Therefore, an additional long-termnoses among 9 females. The prenatal diagnosisnancies without informative markers. The diag-a male fetus. T

he female at risk with a male fetusto take the 50% chance of a normal son. Unfortu-nately, the male fetus was affected by hemophilia.termination of pregnancy with an affected maleIn cases of non-informative genotypicprenatal diagnosis. The advanced technology offrom the cord insertion. An obstetrician skilledin this procedure is essential for success. The riskof fetal loss is 1-2% from fetal blood samplingand 2-3% from chorionic villi sampling (Daffosstudy, no fetal loss occurred from the 11 preg-is cost-effective. It should be adopted by otheris inadequate. The utilized budget for preventiontherapy. In the present study, the replacementat risk. The initial step is to identify the obligatenotypic analysis. The additional genotypic analy-sis is provided to obligate, proven and undeter-mined carriers within the reproductive life. Then,prenatal diagnosis by either tracking the infor-males at risk. The overall cost of prevention ismophiliac patients. Therefore, the service for car-Betke K, Sanguansermsri T. ZytologischeBlutfarbstoff-differenzierung. Moglichkeiten,Ergebnisse and Nutzanwen-dungen. 1972; 114: 1099-104.Chuansumrit A, Krasaesub S, Ang-chaisuksiri P,Hathirat P, Isarangkura P. Survival analysis ofThromb Haemost Daffos F, Capella-Pavlovsky M, Forestier F. Fetal bloodPrenatGoodeve AC, Tagariello G, Chuansumrit A, PrestonFE, Peake IR. A rapid and cost

effective methodin the factor VIII gene. EALTH Hardisty RM, Macpherson JC. A one-stage factor VIIIThromb DiathHaemorrhHogge WA, Schonberg SA, Golbus MS. Chorionic villiIsarangkura P. Haemophilia care in the developingchromosome diagnosis. In: Ajjimakorn S, ed. Pre- Bangkok: Arsornsamai, 1992; 71-99.Kasper CK, Mannucci PM, Bulyzhenkov V, . He-Semin Thrombphilia A. In: Innis MA, Gelfand DH, Sninsky TJ,White TJ, eds. PCR protocol: A guide to methodsand applications. San Diego: Academic Press,Kunkel LM, Smith KD, Boyer SH, . Analysis of hu-man Y-chromosome-specific reiterated DNA inProc Natl Acad Sci USAPeake I, Lillicrap DP, Boulyjenkov V, . Report ofa joint WHO/WFH meeting on the control ofPintadit P, Chuansumrit A, Chotsupakarn S, KrasaesubS, Panthangkul P, Isarangkura, P. Carrier detectionin hemophilia A by using the ratio of factor VIIIclotting activity and von Willebrand factor anti-Thai J Hematol Transf MedPitney WR. Assay of factor IX. In: Dacie JV, LeviesRurgkhum S, Sasanakul W, Chotsuppakarn S, PintaditChuansumrit A. The limitation of factor IX co-hemophilia B carrier. J Med Assoc Thai2002; 85Saiki RK, Gelfand DH, Stoffel S, . Primer-directedSasanakul W, Chuansumrit A, Rurgkhum S, Hathirat P.with the factor IX gene in the Thai population.oyozumi H, Kojima T, Matsushita T. Hamaguchi M,carrier using two novel dinucleotide polymor-Thromb Haemost