/
Genetic Technologies  — Lecture V Genetic Technologies  — Lecture V

Genetic Technologies — Lecture V - PowerPoint Presentation

danika-pritchard
danika-pritchard . @danika-pritchard
Follow
350 views
Uploaded On 2018-09-23

Genetic Technologies — Lecture V - PPT Presentation

Dr Steven J Pittler WORB 658 Office 46744 Cell 6129720 Suggested Reading Lewis 7 th Edition Human Genetics Concepts and Applications Chapter 19 Genetic Technologies FETAL TESTING Amniocentesis ID: 677180

enzyme dna copied polymerase dna enzyme polymerase copied single complement specific stick strand cut tgacagctacagcagcagcatcgacgactagcatcgatcga cell gel motifs sites

Share:

Link:

Embed:

Download Presentation from below link

Download Presentation The PPT/PDF document "Genetic Technologies — Lecture V" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript