Megan Frayer PhD Student Laboratory of Genetics UWMadison HTCondor Week 2022 Genetics of Speciation Genetics of Speciation Genetics of Speciation Genetics of Speciation Genetics of Speciation ID: 999118
Download Presentation The PPT/PDF document "Genomic Ancestry Analysis in Wild Hybrid..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
1. Genomic Ancestry Analysis in Wild Hybrid House MiceMegan FrayerPh.D. Student, Laboratory of GeneticsUW-MadisonHTCondor Week 2022
2. Genetics of Speciation
3. Genetics of Speciation
4. Genetics of Speciation
5. Genetics of Speciation
6. Genetics of Speciation
7. Genetics of Speciation
8. The house mouse hybrid zone can tell us about how speciation is proceeding between these subspecies M. m. domesticusM. m. musculus
9. The house mouse hybrid zone can tell us about how speciation is proceeding between these subspecies M. m. domesticusM. m. musculus
10. The house mouse hybrid zone can tell us about how speciation is proceeding between these subspecies M. m. domesticusM. m. musculus
11. The house mouse hybrid zone can tell us about how speciation is proceeding between these subspecies M. m. domesticusM. m. musculus
12. The house mouse hybrid zone can tell us about how speciation is proceeding between these subspecies M. m. domesticusM. m. musculus
13. The house mouse hybrid zone can tell us about how speciation is proceeding between these subspecies M. m. domesticusM. m. musculus
14. ATCGTCAGTCAGTCGATCGATACGTAGCATGCAGTACGATGCAGTACGATGATACGTAGCAGTCAGACACGTAGCTATGCATCGTACGTCATGCTACGTCATGCTACTATGC
15. ATCGTCAGTCAGTCGATCGATACGTAGCATGCAGTACGATGCAGTACGATGATACGTAGCAGTCAGACACGTAGCTATGCATCGTACGTCATGCTACGTCATGCTACTATGC
16. ATCGTCAGTCAGTCGATCGATACGTAGCATGCAGTACGATGCAGTACGATGATACGTAGCAGTCAGACACGTAGCTATGCATCGTACGTCATGCTACGTCATGCTACTATGC
17. DOMHETMUS Centromere Telomere
18. Parameter grid search
19. Parameter grid searchWhat is the combination of input parameters with the highest likelihood?
20. Parameter grid searchParameter Values to be testeddefaultRate 0.80.860.991.15 timeSince Admixture 10003750650092501200014750 ancestryProp1 0.40.50.6 ancestralRate1 410006925097500 ancestralRate2 140002365033290208153515849500 mutation1 1E-041E-051E-061E-071E-08 mutation2 3.4E-053.4E-063.4E-073.4E-083.4E-095.1E-055.1E-065.1E-075.1E-085.1E-09miscopyRate 0.010.0011E-041E-051E-06 Miscopy Mutation 0.010.0011E-041E-051E-06
21. Parameter grid searchParameter Values to be testeddefaultRate 0.80.860.991.15 timeSince Admixture 10003750650092501200014750 ancestryProp1 0.40.50.6 ancestralRate1 410006925097500 ancestralRate2 140002365033290208153515849500 mutation1 1E-041E-051E-061E-071E-08 mutation2 3.4E-053.4E-063.4E-073.4E-083.4E-095.1E-055.1E-065.1E-075.1E-085.1E-09miscopyRate 0.010.0011E-041E-051E-06 Miscopy Mutation 0.010.0011E-041E-051E-06 108,000 combinations of parameters to be tested
22. Parameter grid searchParameter Values to be testeddefaultRate 0.80.860.991.15 timeSince Admixture 10003750650092501200014750 ancestryProp1 0.40.50.6 ancestralRate1 410006925097500 ancestralRate2 140002365033290208153515849500 mutation1 1E-041E-051E-061E-071E-08 mutation2 3.4E-053.4E-063.4E-073.4E-083.4E-095.1E-055.1E-065.1E-075.1E-085.1E-09miscopyRate 0.010.0011E-041E-051E-06 Miscopy Mutation 0.010.0011E-041E-051E-06 108,000 combinations of parameters to be tested
23. Parameter grid search
24. Parameter grid search
25. Create Input Filesparameter_test.dag
26. Create Input Filesparameter_test.dagExamples of files to print: Submit filesExecutablesInput for programs being runScripts that will need to be run
27. Create Input FilesParameter Test 1parameter_test.dag
28. Create Input FilesParameter Test 1Parameter Test 2parameter_test.dag
29. Create Input FilesParameter Test 1Parameter Test 2Parameter Test 3parameter_test.dag
30. Create Input FilesParameter Test 1Parameter Test 2Parameter Test 3Parameter Test nparameter_test.dag
31. Create Input FilesParameter Test 1Parameter Test 2Parameter Test 3Parameter Test nCompile results/create summariesparameter_test.dag
32. Create Input FilesParameter Test 1Parameter Test 2Parameter Test 3Parameter Test nCompile results/create summariesparameter_test.dagSUBDAG_EXTERNAL
33. Create Input FilesParameter Test 1Parameter Test 2Parameter Test 3Parameter Test nCompile results/create summariesparameter_test.dagSUBDAG_EXTERNALBefore HTC: 2 hours/test 24.6 years/108,000 testsWith HTC: 2 hours/test 10 days/108,000 tests24.6 years 10 days
34. Testing with Simulated Chromosomes
35. Testing with Simulated ChromosomesHow well is the program performing?
36. Testing with Simulated Chromosomes
37. Testing with Simulated Chromosomes
38. Create Input FilesSet 1Set 2Set 3Set nCompile results/create summariesinference_testing.dagSet 1Inference Test Set 1Set 1Inference Test Set 2Set 1Inference Test Set 3Set 1Inference Test Set nParameter Set 1Parameter Set 2Parameter Set nParameter SetsParameter Set 3
39. Create Input Filesinference_testing.dagParameter Set 1
40. Create Input FilesInference Test Set 1inference_testing.dagParameter Set 1
41. Create Input FilesInference Test Set 1inference_testing.dagParameter Set 1Inference Test Set 1
42. Create Input FilesInference Test Set 1inference_testing.dagParameter Set 1Set 1Inference Test Set 1
43. Create Input FilesSet 1Set 2inference_testing.dagSet 1Inference Test Set 1Set 1Inference Test Set 2Parameter Set 1Parameter Set 2
44. Create Input FilesSet 1Set 2Set 3inference_testing.dagSet 1Inference Test Set 1Set 1Inference Test Set 2Set 1Inference Test Set 3Parameter Set 1Parameter Set 2Parameter Set 3
45. Create Input FilesSet 1Set 2Set 3Set ninference_testing.dagSet 1Inference Test Set 1Set 1Inference Test Set 2Set 1Inference Test Set 3Set 1Inference Test Set nParameter Set 1Parameter Set 2Parameter Set nParameter SetsParameter Set 3
46. Create Input FilesSet 1Set 2Set 3Set nCompile results/create summariesinference_testing.dagSet 1Inference Test Set 1Set 1Inference Test Set 2Set 1Inference Test Set 3Set 1Inference Test Set nParameter Set 1Parameter Set 2Parameter Set nParameter SetsParameter Set 3
47. Create Input FilesSet 1Set 2Set 3Set nCompile results/create summariesinference_testing.dagSet 1Inference Test Set 1Set 1Inference Test Set 2Set 1Inference Test Set 3Set 1Inference Test Set nParameter Set 1Parameter Set 2Parameter Set nParameter SetsParameter Set 3Before HTC: 3 hours/test 6.25 days/50 testsWith HTC: 3 hours/test 10 hours/50 tests6.25 days 10 hours
48. Simulations
49. Simulations
50. simulation.dagReplicate 1Replicate 2Replicate 3Replicate n Simulation.configDAGMAN_MAX_JOBS_IDLE = 1000VariablesTemplate Submit Files
51. simulation.dagReplicate 1Replicate 2Replicate 3Replicate n Simulation.configDAGMAN_MAX_JOBS_IDLE = 1000VariablesTemplate Submit Files
52. simulation.dagReplicate 1Replicate 2Replicate 3Replicate n Simulation.configDAGMAN_MAX_JOBS_IDLE = 1000VariablesTemplate Submit Files
53. simulation.dagReplicate 1Replicate 2Replicate 3Replicate n Simulation.configDAGMAN_MAX_JOBS_IDLE = 1000VariablesTemplate Submit Files
54. simulation.dagReplicate 1Replicate 2Replicate 3Replicate n Simulation.configDAGMAN_MAX_JOBS_IDLE = 1000VariablesTemplate Submit FilesBefore HTC: 2 hours/test 2.7 years/12,000 testsWith HTC: 2 hours/test 30 hours/ 12,000 tests 2.7 years 30 hours
55. simulation.dagReplicate 1Replicate 2Replicate 3Replicate n Simulation.configDAGMAN_MAX_JOBS_IDLE = 1000VariablesTemplate Submit FilesBefore HTC: 2 hours/test 2.7 years/12,000 testsWith HTC: 2 hours/test 30 hours/ 12,000 tests 2.7 years 30 hours
56. ConclusionHTC can improve research in biological sciences Even simple DAGs can make a big impact on your research DAGs can also improve reproducibility like automated pipelines
57. ConclusionHTC can improve research in biological sciences Even simple DAGs can make a big impact on your research DAGs can also improve reproducibility like automated pipelines
58. ConclusionHTC can improve research in biological sciences Even simple DAGs can make a big impact on your research DAGs can also improve reproducibility like automated pipelines
59. ConclusionHTC can improve research in biological sciences Even simple DAGs can make a big impact on your research DAGs can also improve reproducibility
60. ConclusionHTC can improve research in biological sciences Even simple DAGs can make a big impact on your research DAGs can also improve reproducibilityIn the last year, I have used 8.5 million HTC hours.
61. ConclusionHTC can improve research in biological sciences Even simple DAGs can make a big impact on your research DAGs can also improve reproducibilityHTC has shortened my Ph.D. by almost 1,000 years.