The yarn represents DNA DNA is a tiny long thin chemical How does the yarn resemble DNA If we looked closely at the DNA inside each of your cells it would look like a twisted ladder ID: 185648
Download Presentation The PPT/PDF document "YARN MODEL OF DNA/GENES/CHROMOSOMES" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Slide1
YARN MODEL OF DNA/GENES/CHROMOSOMESSlide2
The yarn represents DNA.
DNA is a tiny, long, thin chemical.
How does the yarn resemble DNA?Slide3
If we looked closely at the
DNA inside each of your cells,
it would look like a twisted ladder.
Sort of like this…
Look again
at the yarn.
How does the yarn remind you of DNA?
Slide4
Did you notice the letters
in the image of DNA?
What are the four letters? Slide5
These four substances
are what allow
DNA to be a type of chemical code. Slide6
Putting them together, you
might get something like this…Slide7
You’ve seen codes before.
Look at this code:
19-3-9-5-14-3-5 18-15-3-11-19 Anyone know what
this code says?Slide8
Decoded, it means….
Science Rocks!
(A=1, B=2, etc.)Slide9
DNA carries the information
(the code) that tells your
cells how to make traits. This code, for example…
ATTCGTAAACGCGAATTGCTCA GATTCGTAAACGCGAATTGCTCAGmight give you dark eyes.Slide10
What are some
examples of traits?Slide11
Eye colorSlide12
Can Roll Tongue Cannot Roll TongueSlide13Slide14
A section of code (DNA) that
gives information for building
a single trait is called a GENE.
GenesSlide15
On your yarn, the different
colors represent different
genes.
Perhaps the
green
section
has the code for eye color.
Maybe the
pink
section has
the code for earlobe shape.Slide16
How many different
genes do you have
on your yarn DNA?On real DNA you might have hundreds of genes since real
DNA is very, very long.Slide17
Sometimes these long,
loose strands of DNA
need to get organized. For example, this happens before cells divide. Slide18
Organized DNA is
called a
chromosome.Your next task is to create a chromosome
.Slide19
Hold one end of the yarn DNA against the popsicle stick and carefully wind the yarn DNA around the stick in a
single layer. Slide20
Now, you have a
chromosome.
Are the genes still there? How do you know?
What are genes made of?Slide21
How does your model compare to this actual
CHROMOSOME?
This is really
a duplicated (or doubled) chromosome.Slide22
Summary Questions
:Slide23
What part of this model represents DNA? Genes? Slide24
Compare and Contrast DNA before and after it is in a chromosome.Slide25
Which do you think is
easier to see in a microscope loose DNA or DNA organized into chromosomes? Why?
DNA strands lying between 2 silicon pillars. 12/3/12Slide26
Fact First Questions:Slide27
The yarn represents DNA.
Explain how yarn and DNA are similar. Slide28
The yarn
colors represent genes.
How are the yarn colors and genes related?Slide29
DNA is a chemical code made up of 4 substances: A, T, C, and G.
How is the DNA chemical code used? Slide30
Chromosomes are formed
when DNA gets organized.
Explain the advantages of DNA creating chromosomes.