Nucleic acids Structure , Function & Repair - PowerPoint Presentation

1. Nucleic acidsStructure , Function & Repair Lecturer 7 Dr. Shaimaa Munther

2. General Introduction Nucleic acids are required for the storage and expression of genetic information. There are two chemically distinct types of nucleic acids: (DNA) and (RNA). DNA, the store house of genetic information, is present not only in chromosomes in the nucleus of eukaryotic organisms, but also in mitochondria and the chloroplasts of plants. Prokaryotic cells, which lack nuclei, have a single chromosome, but may also contain DNA in the form of plasmids.

3. General Introduction DNA must be able to not only replicate precisely each time a cell divides, but also to have the information that it contains be selectively expressed. Expression occurs in 2 stages : Transcription : ( RNA synthesis) is the first stage in the expression of genetic information. Translation : Next step, the code contained in the nucleotide sequence of messenger RNA molecules is translated (protein synthesis), thus completing gene expression. This flow of information from DNA to RNA to protein is termed the "central dogma of molecular biology" and is descriptive of all organisms, with the exception of some viruses that have RNA as the repository of their genetic information.

4. Central Dogma of Biology

5. DNA ( Deoxyribose Nucleic Acid( In eukaryotes individual DNA molecules are found in the chromosomes of the nucleus and in mitochondria. They are large polymers, of nucleutide, (the basic repeat unit of a DNA strand) . DNA is formed by nucleotides arranged consecutively, in two opposite strands and these two strands are wound around each other, forming a double helix .

6. DNA is a nucleic acid, made of long chains of nucleotidesDNA are polymers of nucleotidesNucleotidePhosphate groupNitrogenous baseSugarPolynucleotideSugar-phosphate backboneDNA nucleotidePhosphategroupNitrogenous base(A, G, C, or T)Thymine (T)Sugar(deoxyribose)

7. RNARIBONUCLEIC ACIDRNA is a Polynucleotide , usually present as single stranded found in all cell types.There are three major classes of RNA :– mRNA (messenger RNA) – tRNA (transfer RNA) – rRNA (ribosomal RNA) All are synthesized from DNA base sequences

8. Types of RNAType of RNAFunctions inFunctionMessenger RNA(mRNA)Nucleus, migratesto ribosomesin cytoplasmCarries DNA sequenceinformation to ribosomesTransfer RNA(tRNA)CytoplasmProvides linkage between mRNAand amino acids;transfers aminoacids to ribosomesRibosomal RNA(rRNA)CytoplasmStructural component of ribosomes

9. NucleotidesNucleic acids (DNA and RNA) are assembled from nucleotides, which consist of three components: a nitrogenous basea five-carbon sugar (pentose)Phosphate group.Important Note:Nucleosides are similar to nucleotides but have no phosphate groups.

10. Nucleotides v.s Nucleosides

11. nitrogenous basesThere are two types of nitrogen-containing bases commonly found in nucleotides: purines and pyrimidinesPurines contain two rings in their structure. The two purines commonly found in nucleic acids are adenine (A) and guanine (G); both are found in DNA and RNA. Other purine metabolites, not usually found in nucleic acids, include xanthine, hypoxanthine, and uric acid.Pyrimidines have only one ring. Cytosine (C) is present in both DNA and RNA. Thymine (T) is usually found only in DNA, whereas uracil (U) is found only in RNA.

12. nitrogenous bases

13. Five-Carbon SugarsNucleic acids (as well as nucleosides and nucleotides) are classified according to the pentose they contain. If the pentose is ribose, the nucleic acid is RNA (ribonucleic acid). If the pentose is deoxyribose, the nucleic acid is DNA ( deoxyribonucleic acid).

14. Functions of NucleotidesNucleoside 5'-triphosphates are carriers of energy Bases serve as recognition units Cyclic nucleotides are signal molecules and regulators of cellular metabolism and reproduction ATP is central to energy metabolism GTP drives protein synthesis CTP drives lipid synthesis UTP drives carbohydrate metabolism

15. NUCLEIC ACIDSNucleic acids are polymers of nucleotides joined by 3', 5'-phosphodiester bonds; that is, a phosphate group links the 3' carbon of a sugar to the 5' carbon of the next sugar in the chain. Each strand has a distinct 5' end and 3' end, and thus has polarity. A phosphate group is often found at the 5' end, and a hydroxyl group is often found at the 3' end.The base sequence of a nucleic acid strand is written by convention, in the 5' 3‘ direction (left to right). In eukaryotes, DNA is generally double-stranded (dsDNA) and RNA is generally single-stranded (ssRNA). Exceptions occur in certain viruses, some of which have ssDNA genomes and some of which have dsRNA genomes.

16. Phosphodiester linkages between nucleotides (in DNA or RNA) can be cleaved hydrolytically by chemicals, or hydrolyzed by a family of nucleases:deoxyribonucleases for DNA ribonucleases for RNA. Note: Nucleases that cleave the nucleotide chain at positions in the interior of the chain are called endonucleases. Those that cleave the chain only by removing individual nucleotides from one of the two ends are called exo nucleases.

17. Phosphodiester linkages

18. Double helix In the double helix, the two chains are coiled around a common axis called the axis of symmetry. The chains are paired in an antiparallel manner, that is, the 5'-end of one strand is paired with the 3'-end of the other strand. The spatial relationship between the two strands in the helix creates a major (wide) groove and a minor (narrow) groove. These grooves provide access for the binding of regulatory proteins to their specific recognition sequences along the DNA chain.

19. Watson-Crick model for the structure of DNA

20. The bases of one strand of DNA are paired with the bases of the second strand, so that an adenine is always paired with a thymine and a cytosine is always paired with a guanine.The specific base pairing in DNA leads to Rules: Any sample of double-stranded DNA, the amount of adenine equals the amount of thymine, the amount of guanine equals the amount of cytosine.The base pairs are held together by hydrogen bonds: two between A and T and three between G and C These hydrogen bonds, plus the hydrophobic interactions between the stacked bases, stabilize the structure of the double helix.Base pairing

21. Hydrogen bonds between bases hold the strands together: A and T, C and GPartial chemical structureHydrogen bond

22. DNA replication

23. The eukaryotic cell cycle The events surrounding eukaryotic DNA replication and cell division (mitosis) are coordinated to produce the cell cycle . The period preceding replication is called the G1 phase (Gap1).DNA replication occurs during the S (synthesis) phase. Following DNA synthesis, there is another period (G2 phase, Gap2) before mitosis (M). Cells that have stopped dividing, such as mature neurons, are said to have gone out of the cell cycle into the G0 phase. [Note: Some cells leave the G0 phase and reenter the early G1 phase to resume division.]

24. The eukaryotic cell cycle

25. DNA Replication steps Replication = DNA copies itself exactly Occurs within the nucleus Any mistake in copying = mutation DNA mutation = chromosomal mutation One side of DNA molecule is a template for making the other side strand

26. DNA replication In order for the two strands of the parental double helical DNA to be replicated, they must first separate (or "melt"), at least in a small region, because the polymerases use only single-stranded DNA as a template. Prokaryotic organisms, DNA replication begins at a single, unique nucleotide site called the origin of replication . Replication begins at multiple sites along the DNA helix. These sites include a short sequence composed almost exclusively of AT base pairs.

27. DNA replication When the two strands of the DNA double helix are separated, each can serve as a template for the replication of a new complementary strand. This produces two daughter molecules, each of which contains two DNA strands with an antiparallel orientation .The enzymes involved in the DNA replication process are template-directed polymerases that can synthesize the complementary sequence of each strand with extraordinary fidelity.

28. DNA replication begins at many specific sitesParental strandOrigin of replicationBubbleTwo daughter DNA molecules

29. Formation of the replication fork As the two strands unwind and separate they form a "V" where active synthesis occurs.This region is called the replication fork. moves along the DNA molecule as synthesis occurs. The replication forks move in both directions away from the origin

30. DNA replication

31. Process of DNA ReplicationUncoil & unzip DNA molecule by specific enzymes with the aid of specific proteins ; the enzyme helicase breaks the weak hydrogen bond between bases.The enzyme polymerase brings in complementary N-bases.Prokaryotic and eukaryotic DNA polymerases elongate a new DNA strand by adding deoxyribonucleotides, one at a time, to the 3'-end of the growing chain . The sequence of nucleotides that are added dictated by the base sequence of the template strand with which the incoming nucleotides are paired.

32.

33. DNA expressionThe information constituting an organism’s genotype is carried in its sequence of basesThe DNA information is expressed as it transcribed into RNA, which is then translated into the polypeptideTRANSCRIPTIONTRANSLATIONDNARNAProtein

34. 1- DNA TranscriptionThe first step in DNA expression is transcription.Transcription : Is the first stage in the expression of genetic information.It is started by mRNA synthesis , and occurs withen the nucleus.

35. Transcription produces genetic messages in the form of mRNARNA polymeraseRNA nucleotideDirection of transcriptionNewly made RNATemplatestrand of DNA

36. Translation : Next step, the code contained in the nucleotide sequence of messenger RNA molecules is translated (protein synthesis), thus completing gene expression. The “words” of the DNA “language” are triplets of bases called codons.The codons in a gene specify the amino acid sequence of a polypeptide2- Translation of nucleic acids into amino acids

37. UCAGUCAGGACUGACUGACUGACUUUUUUCUUAUUGCUUCUCCUACUGAUUAUCAUAAUGGUUGUCGUAGUGpheleuleuilemet (start)valUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGserprothralaUAUUACUAAUAGCAUCACCAACAGAAUAACAAGAAAGAUGACGAAGAGtyrstopstophisglnasnlysaspgluUGUUGCUGAUGGCGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGGcysstoptrpargserargglyFirst BaseThird BaseSecond BaseVirtually all organisms share the same genetic code “unity of life”

38. An exercise in translating the genetic codeStart codonRNATranscribed strandStop codonTranslationTranscriptionDNAPolypeptide

39. DNA moleculeGene 1Gene 2Gene 3DNA strandTRANSCRIPTIONRNAPolypeptideTRANSLATIONCodonAmino acid

40. In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptideThe process is aided by transfer RNAsEach tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the otherTransfer RNA molecules serve as an interpreters during translationHydrogen bondAmino acid attachment siteRNA polynucleotide chainAnticodonAmino acidattachment siteAnticodon

41. Ribosomes build polypeptidesCodonsmRNAmRNAbindingsiteP siteA sitePAGrowingpolypeptidetRNANext amino acidto be added topolypeptide

42. 1Initiator tRNAmRNAStart codonSmall ribosomal subunit2P siteLarge ribosomal subunitA sitemRNA , a specific tRNA, and The Ribosome Subunits assemble during initiation

43. Summary of transcription and translation1 TRANSCRIPTION Stage mRNA is transcribed from aDNA template.AnticodonDNAmRNARNA polymeraseEnzymeAmino acidtRNAInitiator tRNALarge ribosomal subunitSmall ribosomal subunitmRNAStart Codon2TRANSLATION Stage Each amino acid attaches to its proper tRNA with the help of a specific enzyme and ATP.3Initiation of polypeptide synthesis

44. 4Codon recognitionAmino acidAnticodonAsiteP sitePolypeptide5Peptide bond formation6TranslocationNew peptide bondmRNAmovementmRNAStop codon Summary of transcription and translation (continue)

45. 7Elongation Stage GrowingpolypeptideCodons8Termination StagemRNANewpeptidebondforming Stop CodonThe ribosome recognizes a stop codon. The poly-peptide is terminated and released.PolypeptideA succession of tRNAs add their amino acids to the polypeptide chain as the mRNA is moved through the ribosome, one codon at a time. Summary of transcription and translation (continue)

46.