/
Candidate Gene Polymorphisms of Renin Angiotensin System andEssential Candidate Gene Polymorphisms of Renin Angiotensin System andEssential

Candidate Gene Polymorphisms of Renin Angiotensin System andEssential - PDF document

tawny-fly
tawny-fly . @tawny-fly
Follow
408 views
Uploaded On 2015-09-27

Candidate Gene Polymorphisms of Renin Angiotensin System andEssential - PPT Presentation

INTRODUCTION as anticoagulant The genomic DNA was ex ID polymorphism was determined by alTiret et al 1992 ID were 5CTGGAGAGCCACTCCCATCCTTTCT3 Forward and5GACGTGGCCATCACATTCGTCAGAT3 R ID: 142162

INTRODUCTION as anticoagulant. The genomic DNA

Share:

Link:

Embed:

Download Presentation from below link

Download Pdf The PPT/PDF document "Candidate Gene Polymorphisms of Renin An..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript