Download presentation
1 -

Data Sheet


ProductpMCs-PuroRetroviralVectorCATALOG NUMBERRTV-041STORAGE-20CQUANTITY AND CONCENTRATION10 g at 025 g/Lin TEBackgroundRetroviruses are efficient tools for delivering heritable genes into the genome

hadly's Recent Documents

SPECIFICATION
SPECIFICATION

SPE-12-8-118/B/WYPage 1of 26PATENT PENDINGPart NoTG308111 ApexProduct Name Apex Black Straight TG30Ultra-Wideband 4G LTE Antenna FeatureLTE / GSM / CDMA /DCS /PCS / WCDMA / UMTS / HSDPA / GPRS / EDGE

published 0K
Office of Foreign Assets Control US Department of the Treasury
Office of Foreign Assets Control US Department of the Treasury

OFFICE OF FOREIGN ASSETS CONTROL REPORT OF LICENSING ACTIVITIES PURSUANT TO THE TRADE SANCTIONS REFORM AND EXPORT ENHANCEMENT ACT OF 2000 April - June 2004 Overview This report is submitted pu

published 0K
10 EUTIVE SUMMARYBecoming the food bowl of Asia opportunity and challe
10 EUTIVE SUMMARYBecoming the food bowl of Asia opportunity and challe

IIIIICONTENTS1KEY THEMESStrong agricultural demand combined with growing supply constraints are driving an enormous opportunity for agricultural tradeAustralia and New Zealand stand to capture an addi

published 0K
ABCAB3BF6GC
ABCAB3BF6GC

-/235666x00008GI8GE9AIJ6B6KA8L33O6A68PQPRSTQTSRSVQPSTSQTQQQXSQSSYTTQTQSTTPPSZ1TQPSQQWPPSQPQQQQQPQQS0TPTSPSQQTSSTRTQQSQQSQSQQQQSSXQQQTQPTQPPSSQQPQQQQ -/2345676898668x00006A28B8C7Dx0000E/EFGEEEFIJKILJM

published 0K
International Journal of Caring Sciences                         Janua
International Journal of Caring Sciences Janua

wwwinternationaljournalofcaringsciencesorgOriginal Article Influence of Chronic Disease on Cognitive Functions of Patients Canan Demir Barutcu PhD Assistant Professor Mehmet Akif Ersoy University Facu

published 0K
Ford started the year strong with January retail sales outpacing the e
Ford started the year strong with January retail sales outpacing the e

Ford brand SUVs posted a new record retail sales start in January due to the launch of the all-new Bronco Sport Ford January total truck sales including pickups and vans posted their best January reta

published 0K
x0015x0013x0015x0014x0010x0015x0013x0015x0016
x0015x0013x0015x0014x0010x0015x0013x0015x0016

11803URMHFW2ULJQLQDO 5HTXHVW ORVLQJ XLOGLQJV RQWLQJHQF IRU x0014x001Cx0010x0015x0014 3URMHFW GHODVGGLWLRQDO IXQGLQJ QHHGHG WR FRPSOHWH YDULRXV x0015x0013x0014x001Cx0010x0015x0014 7HQDQW PSURYHPHQW SUR

published 0K
This segment is not used if the claim level Loop ID
This segment is not used if the claim level Loop ID

SecondaryPayerand COB rulesfor Institutional x223A1LoopandSegmentValueDescriptionLoop2000BSubscriberHierarchicalLoopSBR01ABCDEFGH STPayerResponsibilitySequenceNumberCodeThisvaluecannotbe PforCOBclaims

published 0K
Download Section

Download - The PPT/PDF document "" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.






Document on Subject : "Data Sheet"— Transcript:

1 Product Data Sheet pMC s - P
Product Data Sheet pMC s - Puro Retroviral Vector CATALOG NUMBER : RTV - 041 S TORAGE : - 20C QUANTITY AND CONCENT RATION : 10 g at 0. 2 5 g/ L in TE Backgroun d Retroviruses are efficient tools for delivering heritable genes into the genome of dividing cells. Most retrovirus v ector s including pBABE and pMXs are based on Moloney murine leukemia virus (MMLV). M MLV - based vectors usually are si lenced in immature cells including embryonic carcinoma (EC) cells and embryonic stem (ES) cells, and poss ibly hematopoietic stem cells. PC C4 - cell - passaged myeloproliferative sarcoma virus ( PCMV ) are mutants of MMLV and can stably express genes in immature cells including ES cells. Cell Biolabs ’ pMC s - Puro retroviral vector includes hybrid LTRs containing elements from both MMLV an d PCMV an d i s capable of express ing genes in both EC and ES cells. T he vector provides the viral package signal, transcription and processing elements, and MCS for cloning of a target gene. The viral env gene, produced by the package cell line, encodes the envelo p e protein, which determines the viral infectivity range. Transfection into a package cell line produces high - titer, replication - incompetent viruses. In addition to transfer and expression of exogenous genes in mammalian cells, recently, retroviruses hav e been used to express silencing RNAs (siRNA) to decrease the expression of target genes both

2 in vitro and in vivo . The ve
in vitro and in vivo . The vector contains the a mpicillin - resistance gene, LTRs, package signal and MCS for cloning of your gene of interest (Figure 1). Figur e 1. Sche matic representation of pMC s - Puro retroviral vector . 5 ’ - MCS:  Enzyme Sites : 5’ - PacI, BamHI, EcoRI - 3’  MCS Sequence: TTAATTAA GGATCC CAGTGTGGTGGTACGG GAATTC AAGCTT GATC 3 ’ - MCS:  Enzyme Sites: 5’ - EcoRI, XhoI, NotI - 3’  MCS Sequence: GGCG GAATTC CAGCTGAGCG CCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAA TAATAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATTATGT ACTATTTAAA CTCGAGCGGCCGC CAGCACAGTG GTCGAC --- SV40 --- puro - GTCGAC --- Note: For optimal expression, both 5’ MCS and 3’ MCS should be used to clone gene of interest a nd replace the st u ffer sequence (partial LacZ) between them. Safety Consideration Remember that you will be working with samples containing infectious virus. Follow the recommended NIH guidelines for all mater ials containing BSL - 2 organisms. Always w ear glove s , use filtered tips and work under a biosafety hood. References 1. Kitamura T., et al ., (2003) Exp. Hematol. 31 , 1007 - 1014. Recent Production Citation s 1. Handorf, A. et al. (2014). Endogenously Produced Indian Hedgehog R egulates TGFβ - Driven Chondrogenesis of Human Bone Marrow Stromal/Stem Cells. Stem Cells Dev. doi:10.1089/scd.2014.0266. 2. Tang, Y. et al. (2014). Differential ef fects o

3 f Akt isoforms on somatic cell reprog r
f Akt isoforms on somatic cell reprog ramming. J C ell Sci . 127 :3998 - 4008. 3. Mochizunki, Y. et al. (2013). Phosphatidylinositol 3 - phosphatase myotubularin - related pr otein 6 (MTMR6) Is regulated by sm all GTPase Rab1B in the early secretory an d autophagic pa thways. J. Biol. Chem. 288 :1009 - 1021. License Inform ation This product is licensed from the University of Tokyo. W arranty These products are warranted to perform as described in their labeling and in Cell Biolabs literature when used in accordance with their instructions. THERE ARE NO WARRANTIES THAT EXTE ND BEYOND THIS EXPRESSED WARRANTY AND CELL BIOLABS DISCLAIMS ANY IMPLIED WARRANTY OF MERCHANTABILITY OR WARRANTY OF FITNESS FOR PARTICULAR PURPOSE. CELL BIOLABS ’s sole obligation and purchaser’s exclusive remedy for breach of this warranty shall be, at th e option of CELL BIOLABS, to repair or replace the products. In no event shall CELL BIOLABS be liable for any proximate, incidental or consequential damages in connection with the products. This product is for RESEARCH USE ONLY; not for use in diagnostic procedures. Contact Information Cell Biolabs, Inc. 7758 Arjons Drive San Diego, CA 92126 Worldwide: +1 858 - 271 - 6500 USA Toll - Free: 1 - 888 - CBL - 0505 E - mail: tech@cellbiolabs.com www.cellbiolabs.com  2013 - 2015 : Cell Biolabs, Inc. - All rights reserved. No part of these works may be reproduced in any form without permissions in writin