Vol.171,No.12JOURNALOFBACTERIOLOGY,Dec.1989,p.6764-67700021-9193/89/12

Download presentation
1 - 20

miller's Recent Documents

OfficialABSIMOHull
OfficialABSIMOHull

BALLAST WASTEOIL HYDRAULIC POTABLE BOWLINEPULLBRAKECAPACITY LINE (2)2,400'WireRope WINCH Markey POTABLEWATER LUBEOIL HOLDINGTANKS UREA N/A FUELTYPE MGO FUELCAPACITY 103,000gal LINEPULLBRAKECAPACITY BO

published 1K
_________ ____________ VOLUNTARY INSURANCE OF PERSONS TRAVELING U
_________ ____________ VOLUNTARY INSURANCE OF PERSONS TRAVELING U

1 POLICY from (MEDICAL EXPENSES INSURANCE) This Policy confirms the conclusion of the Voluntary Medical Expenses Insurance Contract (hereinafter — the Insurance Contract / Contract) in the manner

published 0K
Product PerformanceTesting MethodWater Absorption Breaking Strength 60
Product PerformanceTesting MethodWater Absorption Breaking Strength 60

OLIVE ZERA WALNUT ANA69-145 OLIVE ANA69-147 CARBON ANA69-149 BIANCO ANA69-157 OYSTER ANA69-141 SILVER ANA69-159 SAND ANA69-143 Thickness 10 mm 3 x 24BullnoseRectified 2 x 2 Mosaic 12 x 12 Sheet1 x 6 S

published 1K
Indiana University History G380
Indiana University History G380

– class text readings – Spring 20 10 – R. Eno SIMA QIAN AND OUR VIEW OF EARLY CHINAAs we have frequently had occasion to note, in the study of early China we owe the greatest debt to

published 0K
Date Printed 11062010 Material Safety Data Sheet
Date Printed 11062010 Material Safety Data Sheet

SOURCE MEDICAL P.O. BOX 7, Station

published 0K
THE MUKO PLAIN Mukogawa Womens University Japan Keywords Muko Riv
THE MUKO PLAIN Mukogawa Womens University Japan Keywords Muko Riv

80 201 Muko Plain and Yomo River as a county boundary The Muko Plain extends over both of the ancient Muko and Kawabe Counties to form the urban area of today’s Nishinomiya and Amagasaki Cities.

published 1K
ProcNatiAcadSciUSAVol88pp77497753September1991GeneticsSeparat
ProcNatiAcadSciUSAVol88pp77497753September1991GeneticsSeparat

Proc.Natl.Acad.Sci.USA88(1991)HMRaade2-1trpl-1can)-100leu2-3,112his3-11,15ura3)asdescribed(13).Fourisogenicstrainswereconstructed,eachwithadifferentformoftheHMREsilencer:wild-type(AEB),hmrAA(del352-35

published 0K
RICI 5000 GatewayProduct SheetRICI 5000 Gateway
RICI 5000 GatewayProduct SheetRICI 5000 Gateway

FETURESFully FTICMHP Each module features four Rear DB25 serial portsDual1U -ration optionsRedundant availableSunhillo’s RICI 5000 Gateway address the needs associated with the elimination of

published 0K
Download Section

Download - The PPT/PDF document "" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.






Document on Subject : "Vol.171,No.12JOURNALOFBACTERIOLOGY,Dec.1989,p.6764-67700021-9193/89/12"— Transcript:

1 Vol.171,No.12JOURNALOFBACTERIOLOGY,Dec.1
Vol.171,No.12JOURNALOFBACTERIOLOGY,Dec.1989,p.6764-67700021-9193/89/126764-07$02.00/0CopyrightX1989,AmericanSocietyforMicrobiologynodO,aNewnodGeneoftheRhizobiumleguminosarumBiovarviciaeSymPlasmidpRLlJI,EncodesaSecretedProteinRUUDA.DEMAAGD,*ANDREH.M.WIJFJES,HERMANP.SPAINK,JOSEE.RUIZ-SAINZ,CARELA.WIJFFELMAN,ROBERTJ.H.OKKER,ANDBENJ.J.LUGTENBERGDepartmentofPlantMolecularBiology,BotanicalLaboratory,LeidenUniversity,Nonnensteeg3,2311VJLeiden,TheNetherlandsReceived23June1989/Accepted20September1989TheregionoftheRhizobiumleguminosarumbiovarviciaeSymplasmidpRLlJI,responsiblefortheproductionandsecretionofapreviouslydescribed50-kilodaltonprotein(R.A.deMaagd,C.A.Wiffelnan,E.Pees,andB.J.J.Lugtenberg,J.Bacteriol.170:4424-4427,1988),wasclonedanditsnucleotidesequencewasdetermined.Anewnodgene,nodO,precededbyapoorlyconservednodbox,wasidentifiedanditstranscriptionalstartsitewasdetermined.ComparisonofitspredictedproteinproductwiththeN-terminalaminoacidsequenceoftheisolatedsecretedproteinshowedthatnodOisthestructuralgeneofthisprotein,althoughthenucleotidesequencepredictedaproteinonly30,002daltonsinsize.ThiscomparisonalsoshowedthatthesecretedproteinisnottheproductofN-terminalprocessingofalargerprecursor.AconventionalN-terminalsignalsequencewasnotdetectedintheNodOprotein.TheNodOproteinhassignificanthomologywithapart(residues720to920)ofthehemolysinprotein(HlyA)ofEscherichiacoli.AnalysisofthetranscriptionalregulationofthenodOgenerevealedthat,incontrastwithothernodpromotersinthisspecies,activityofthenodOpromoterisgreatlyenhancedinthepresenceofmultiplecopiesofthenodDgene.Rhizobiumleguminosarumisagram-negativesoilbacte-riumwhichinducesnodulesontherootsofplantsofthefamilyLeguminosae(32).Withinthesenodulesthebacteria,differentiatedintobacteroids,fixatmosphericnitrogen.Bacterialgenes,whichareessentialfornoduleformation(nodgenes)andnitrogenfixation(fixandnifgenes),arelocatedonlargeSym(symbiosis)plasmids(5,11,14).Expressionofnodgenesisinducedbyflavonoids,whichareexcretedbythehostplantroots,andrequiresthenodDgeneproduct(10,19,21,23,24,29,35).Inanearlierstudyweidentifiedasecreted,flavonoid-inducible,Symplasmid(pRLlJI)-dependentproteinofR.leguminosarumbiovarviciaewithanapparentmolecularsizeof50kilodaltons(kDa)(3).ProductionofthisproteinwasgreatlyenhancedinthepresenceofmultiplecopiesofthenodDgene.WehaveproducedmutantslackingthisproteinandidentifiedaregionontheSymplasmidpRLlJIresponsibleforitsproduction(2).Dependingonthebacterialchromosomalbackgroundandthehostplantspecies,muta-tionsinthisregioneitherdonotaffectnodulationordelaynodulationandresultinlowernodulenumbersperplant.Noimmunologicallycross-reactingproteinswerefoundinstrainsofotherbiovars,suggestingthatthisproteinmaybeuniqueforR.leguminosarumbiovarviciaestrains.The50-kDaproteindescribedbyusisthefirstsecretedproteinreportedforR.leguminosarum.InthispaperwedescribethecloningofthepRLlJIregioninvolvedintheproductionofthesecretedproteinandthedeterminationofthenucleotidesequenceofboththestructuralgenefortheproteinandtheprecedingpromoterregion.Thetranscrip-tionalregulationofthisgene,whichappearstobedifferentfromthatofearlieridentifiednodgenes,isalsocharacter-ized.*Correspondingauthor.MATERIALSANDMETHODSStrainsandplasmids.RelevantstrainsandplasmidsusedinthisstudyarelistedinTable1.Enzymesandchemicals.Lyophilizedlargefragment(Kle-now)ofDNApolymeraseIwasobtainedfromBethesdaResearchLaboratories,Inc.(Gaithersburg,Md.).ASeque-naseversion2.0kitwasobtainedfromRijnlandChemischeProduktenenInstumentenhandel(Capellea/dIJssel,TheNetherlands).Polynucleotidekinaseandreversetran-scriptasewereobtainedfromPromegaBiotech(Leiden,TheNetherlands).AllotherenzymesandM13primerswerepurchasedfromBoehringerGmbH(Mannheim,FederalRepublicofGermany).OtherprimersforsequencingwereobtainedfromIsogenBioscience(Amsterdam,TheNether-lands).[a-35S]dATP,[a-35S]dCTP,and[-y-32P]dATPwerepurchasedfromAmershamInternationalplc(Amersham,UnitedKingdom).Allenzymeswereusedaccordingtothespecificationsofthemanufacturers.DNAsequencing.DNAsequencingwasperformedonbothstrands,usingthedideoxychainterminationmethod(26)withtheM13vectorstg130andtgl31(15)andlargefragment(Klenow)ofDNApolymeraseI.Asacontrol,allsequenceswerealsoanalyzedbyusingtheSequenase2.0kitwithdITPinsteadofdGTPinthechainterminationreactions.Someregionswithstrongsecondarystructureswereconfirmedbyrunningsequencegelssupplementedwith50%deionizedformamide.RestrictionsitesusedforcloninginM13wereHindIII,BglII,EcoRI,SphI,Sall,PstI,andBamHI.DNAisolationandplasmidconstructs.RecombinantDNAtechniqueswerecarri

2 edoutessentiallyasdescribedbyManiatiseta
edoutessentiallyasdescribedbyManiatisetal.(17).Broad-host-rangeplasmidsweremobi-lizedfromEscherichiacolitoR.leguminosarum,usingpRK2013asahelperplasmid(4).Selectionoftransconju-gantswasdoneonYMBmedium(12)withtheadditionof5mgofchloramphenicoland500mgofstreptomycinperliter(withIncQplasmids)or2mgoftetracyclineperliter(withIncPplasmids)forplasmidselectionand20mgofrifampinperlitertoselectagainstE.coli.6764 nodOENCODESASECRETEDPROTEIN6765TABLE1.StrainsandplasmidsusedinthisstudyStrainorplasmidCharacteristicsSourceorreferenceE.coliKMBL1164A(lac-pro)thiF-P.vandePutteJM1o1A(lac-pro)supEthi(F'traD36proABlaclqlacZAM15)36R.leguminosarumLPR5045bv.trifoliiRCR5,Symplasmidcured,Rifr13RBL5560LPR5045carryingpJB5JI(=pRLlJImep::TnS)14,34RBL5580LPR5045carryingpRLlJI::Tnl831A5Okb,fromwithinnodEtotheleft27PlasmidspIJ1089IncPcarryinga30-kbpRLlJIfragment5pIC20RIntermediarycloningvector18pRK2013Helperplasmidformobilization4M13tgl3OPhagecloningvectorforsequencing15M13tgl31Phagecloningvectorforsequencing15pMP220IncPvectorwithpromoterlesslacZ27pMP190IncQvectorwithpromoterlesslacZ27pMP77IncQvectorwithpromoterlessxylEJ.MaruggapMP157pMP190containingnodDofpRLlJI27pMP240pMP220containingpRLlJIpromoternodABCIJ3pMP280pMP92containingnodDofpRLlJI30pMP454pMP220carryingPstI-BgIIfragmentofpRLlJIcontainingnodOThisstudypMP455pMP220carryingPstI-BamHIfragmentofpRLlJIcontainingpromoternodOThisstudypMP446pMP220carryingBamHI-BglIIfragmentofpRLlJIcontainingnodOcodingsequenceThisstudypMP468pMP77containingHindIIIfragmentofpMP280withnodDgeneofpRLlJIThisstudyMPM98M13tgl31carryingBglII-PstIfragmentofpRLlJIcontainingpromoternodOThisstudypMP465pMP190withBgIIIfragmentofMPM98containingnodOpromoterandM13primersequenceThisstudyaPh.D.thesis,StateUniversityofUtrecht,TheNetherlands,1988.Determinationoftranscriptionalstartsite.Detailsofthemethodusedfordeterminationofthetranscriptionalstartsitearegivenelsewhere(28).TheBglII-BamHIfragmentcontainingthenodOpromoterwasfirstclonedintheM13tgl31vector,resultinginplasmidMPM98.Subse-quently,aBglIIfragmentofMPM98,containingthenodOpromoterwiththeM13primersequenceatthe3'endwasclonedintheIncQvectorpMP190,resultinginplasmidpMP465.ThisplasmidproducedfusionmRNA,whichcouldbeusedforprimerextensionexperimentswiththe15-merM13sequencingprimer.LPR5045containingpMP465andpMP280(anIncPvectorcontainingnodDofpRL1JI)wasgrownfor8hinthepresenceof100nMnaringenin,andmRNAwasisolatedbymethodsdescribedpreviously(31).PrimerextensionexperimentswereperformedbythemethodofManiatisetal.(17),using32P-end-labeledDNAprimers.TheresultingendproductwascomparedonagelwithasequenceladderofthenoncodingstrandobtainedfromMPM98,whichwassequencedbythedideoxychainterminationmethodwith32P-end-labeledprimer.Inductionassays.AssaysforP-galactosidaseactivity,us-ing100nMnaringeninasthenodgeneinducer,wereperformedasdescribedpreviously(27).Eachtestwasperformedinduplicate,andthevariationoftheexpressionlevelswaswithin20%.Immunodetection.ImmunodetectionofthesecretedNodOprotein,usingWesternblotting(immunoblotting)withrabbitantiserum,wasperformedasdescribedbydeMaagdetal.(2).Aminoacidsequencing.Proteinwasisolatedbyelectro-elutionfromacrylamidegelsasdescribedpreviously(2).Elutedproteinwassubsequentlydialyzedagainstdouble-distilledwater,precipitatedwith9volumesofacetone,andresolubilizedinwaterforaminoacidsequencing.Sequenceanalysiswasperformedwithagasphasesequenator(model470A;AppliedBiosystems),using25%trifluoroaceticacidinwaterastheconversionreagent.Theresultingphenylthio-hydantoinaminoacidswereanalyzedon-linebyreversed-phasehigh-pressureliquidchromatographyonaphenylthio-hydantoinanalyzer(model120A;AppliedBiosystems)withaphenylthiohydantoinC18column(2.1by220mm)(AppliedBiosystems).RESULTSCloningofthepRLlJIregionresponsibleforproductionandsecretionofthe50-kDaprotein.Inourearlierstudy(2)wehaddemonstratedthatpIJ1089,acosmidcloneofpRLlJI,containsaregionwhichisnecessaryforproductionofthesecreted,naringenin-inducible50-kDaprotein.UsingpIJ1089,wesubclonedfragmentsofpRLlJIintothevectorpMP220(27)(Fig.1).ThesesubclonesweresubsequentlyintroducedintoRBL5580.ThisstraincontainsapRLlJIderivativewithalargedeletion,startingwithinthenodEgenetotheleft.Thisplasmidappearedtobelackingaregionnecessaryforproductionofthesecretedprotein(2).CloneswhichcouldcomplementRBL5580forproductionandse-cretionoftheproteinwereselectedbyimmunodetectionwithaspecificantiserumagainstthesecretedprotein.ThisresultedintheisolationofpMP454,containinga1.6-kilobase(kb)PstI-BglIIfragmentsufficientforcomplementationofproductionandsecretionoftheprotein

3 inRBL5580.OurearlierobtainedTnSinsertion
inRBL5580.OurearlierobtainedTnSinsertionsinpIJ1089,inhibitingproduc-tionofthesecretedprotein,weremappedinthesamefragment(2).pMP454,togetherwiththenodDclonepMP157,wassufficienttoenabletheSymplasmid-curedstrainLPR5045toproduceandsecretetheprotein,showingthatbesidesnodDandthe1.6-kbfragment,nootherpartsoftheSymplasmidpRLlJIareessentialforproductionandsecretionoftheprotein.VOL.171,1989 6766DEMAAGDETAL.TNMLEFDABCIJ...........A-oEEEPBBIIpMP446pMP455pMP454FIG.1.RestrictionfragmentsofpRLlJIusedinthisstudy.Solidarrowsshowthepositionsandtranscriptiondirectionsoftheknownnodgenes.Openarrowheadsrepresentknownnodboxes.DashedlinesshowtheapproximatepositionsofthenodTlocus(H.C.J.CanterCremers,H.P.Spaink,A.H.M.Wijfjes,E.Pees,C.A.Wijffelman,R.J.H.Okker,andB.J.J.Lugtenberg,PlantMol.Biol.,inpress)andtheRhilocus(6).HatchedarrowsindicatethesubclonesofpRLlJIusedinthisstudyandtheirorientationtowardsthepromoterlesslacZgeneofthevectorpMP220(seetextandTable1).Restrictionsitesareindicatedasfollows:B,BamHI;E,EcoRI;P,PstI;Bg,BglII;H,HindIII.PstlCCACGCCTGGAGCTGAGGTTTTCGATCTGCAAAGCACCCTGAGATCAGGTGCTCTGCAGATTTGTCTTCAGCGTATACGAGGGAAGAAGTTGTGGCCTTCGTCAACGGCCGCCGATCGTCATAGCCCCCAGTCGTTTTCATATCTGCCGGCCAACTACGAAGGGCGTGCCGTGCGGCCGAnod-boxGATAAACATTTTCGCATCCGTCATTCAAATAGGTCATATCAAAACAATGGATTTCACTAATSSDTTCGCTCTTGGAAAAGATAAGGGGCACAGGCGGCGCCCGTTGCCTAATAAGGAGTATATGCGATGAATATCAAAGGCAGTGATAACGGCAGTTTTATCAAAGGATCCCCTGAAAACGACAMNIKGSDNGSFIKGSPENDIIDGGRNDWIDAGNGDDRIR-AAGCTGGTGACGGCCAAGACAGCATCACGGCCGGTCCGGGCCATGACATTGTCTGGGCCGAGDGQDSITAGPGHDIVWAG-primerGGAAAGGCTCAGACGTAATCCATGCCGACGGTGGTGACGATCTCTTGTACAGCGACGCCTKGSDVIHADGGDDLLYSDAS-YPLYVTDPHRVIPHSGEGDDACGTGCTCTACGCCGGCCCTGGCAGCGATATACTTGTGGCTGGTGACGGCGCAGATGTTCVLYAGPGSDILVAGDGADVLTGACTGGCGGCGACGACGGCGACGCCTTCGTGTTTCGGTTCCACGACCCTATGGTTGGAATGGDDGDAFVFRFHDPMVGTCAACGCACTGCTATACGAGTGTGATGGATTTCGACACGAAGCAGGACCGCTTTGTCCTGGTHCYTSVMDFDTKQDRFVLDACGCCGCAGATTTCGGTGGTGACCGGAATCTGTTTGATGCAAATTTCATCAATCATTCCAAADFGGDRNLFDANFINHSKGFPGEFVDTFYNGAAEGAHGDrimerGCGAGCACGTCGTGGTAATCACTGATCGAGGCTTTGCGTCTGCCGCTGCCGCCGCGACTGEHVVVITDRGFASAAAAATACTATTGATCACGAAGCCCGCGGTGACATCATTGTCTTCCATGATCAAAAAACTCTCGGTCIDHEARGDIIVFHDQKTLGQAAGATGGCGAAACTCACGGTGCGACACTAGCCTATGTCGATTCTGCGAACCACGCGCATGDGETHGATLAYVDSANHAHASphISailICCTTCGCTCATGTCGACAATCTGCACGACATGTCGGATCTTACCTCGCTTACGGCGGAAFAHVDNLHDMSDLTSLTAENATTTCGGCTTCATTTAATTCGATGATCCGAGGAGCGTTCCACCCTTGGGGCGCTTCTCTTFGFI*TTCCAACATGGCGCAGGGAACTGAAAATAGAAACGACGTGATTTTATTGATCGACTGCACCAGTAAAGGTACGCCATTGAAACAAGTTCTCGTCGCCGATGACGACGCCGCCATGCGCCACCTGCATCCTGGGGCGGTTGCGCAAGCTGACTTTCTTCTCGCTGGCTGAGGCCAATGCCGCTATTGGCACTTGATCGCATCAACGATCACCTCATGCGTCGATTGGGTGTTTACCCGGCGEcoRIGCAAGTATTTGAACGTGTCGAACGTGCTGCGCTCGCTAGCCTCCCGGGTGAAACTACGAAHindIIITTCGCXGAATGGCGTCTGCTCCGTGTCTCGACCGATTATCACGTCGAGTTCAAAAGCTTCTTCTATTCCGTCCCTCATGCCCTCATTCGCCAGCAGGTCGATCTTAGAGCAACGGCGCGCACCATCGAATCTSequenceanalysis.ThePstI-BgIIfragmentofpMP454wassubsequentlysequenced.Theresultingsequence,withthefeaturesdescribedbelow,isillustratedinFig.2.Ascreeningforsequencehomologywiththeconsensussequenceofthenodbox(ageneralfeatureofflavonoid-induciblenodgenes[25])revealedanodbox-likesequence(Fig.2)locatedwithinaPstI-BamHIfragment.Alongopenreadingframestarting42basepairsdownstreamofthisnodboxisalsoindicatedinFig.2.ThecodonusageoftheindicatedopenreadingframeisverysimilartothatofthenodA,nodB,andnodCgenesoffast-growingrhizobia,whichsuggeststhattheopenreadingframeisastructuralgene(datanotshown).Theopenreadingframeisprecededbyapossibleribosome-bindingsite(Fig.2).Thisgene,whichwedesignatednodO,codesforaproteinof284aminoacidswithapredictedmolecularsizeof30,002daltons.Totestwhetherthegeneidentifiedabovecodesforthesecretedprotein,wehavecomparedthepredictedaminoacidsequencewiththesequenceoftheelectroelutedproteinasdeterminedbygasphaseaminoacidsequencing.Se-quencingsuccessfullyidentifiedaminoacidresidues4to18ofthepurifiedprotein,andthesematchedthepredictedaminoacidsoftheopenreadingframeinthesamepositions.Residues1to3couldnotbeidentifiedbecauseofcontami-nationbyglycine,probablyfromthegelelectrophoresisusedforpurifyingtheprotein.TheseresultsindicatethatnodOisthestructuralgeneforthesecretedprotein.More-over,theseresultsshowthattheproteinisnotproducedbyN-terminalprocessingofalargerparentalform.Analysisoftheaminoacidsequence,usingthealgorithmofVonHeijneFIG.2.NucleotidesequenceofthePstI-BglIIfragmentofpRLlJIinpMP454(GenBankaccessionnumberM29532).Thetrans-latedaminoacidsequenceofthelargeopenreadingframe(nodO)isgiveninsingle-lettercode.Theprimersusedforsequencing,thepositionoftheputati

4 venodbox,thetranscriptionstartsite(TS),a
venodbox,thetranscriptionstartsite(TS),andaputativeShine-Dalgarnosequence(SD)arealsoindicated.0B1KbRhiH-f'H.BI@IIxJ.BACTERIOL.9EEB..LJpRL11Kbi~~~~~~~~~~~~~~~I241301361421481541601661721781841901961102110811141120112611321138114411501156116211681174118011861 nodOENCODESASECRETEDPROTEIN67678070ua)lUto(nwLiLL4.,0La)ca)a)a)LU.6050403020100-10WINDOW=20aminoacidsMFIDAGKGYVVLTFTOAFGYEFIVDYFFirstaminoacidinwindowFIG.3.HydropathyplotoftheNodOprotein,producedwiththealgorithmofEngelmanetal.(7),usingawindowof20aminoacids.Theverticalaxisshowsthefreeenergyoftransferfromwatertooilinkilocalories(1cal=4.184J)permole.(33),revealednoputativesignalsequenceinvolvedintheexportofprotein.Ahydropathyprofileofthepredictedaminoacidsequence,madewiththealgorithmofEngelmanetal.(7),isshowninFig.3.Almosttheentirelengthoftheproteinappearstobeveryhydrophilic,whichisconsistentwithitspresenceinthegrowthmedium.Furthermore,theproteinhasarelativelyhighcontentofphenylalanine(17residues)andtyrosine(7residues)residues.NodOishomologoustopartofthehemolysinAprotein(HlyA)ofE.coli.TheaminoacidsequenceoftheNodOproteinwascomparedwiththeproteinsequencedatabaseoftheNationalBiomedicalResearchFoundation.ThehighestdegreeofhomologywasfoundwiththeaminoacidsequenceofthehlyAgeneproduct,hemolysin,ofE.coli(9).Thishomologyhadaqualityof120.2(usingtheGenDataBase:SWGapPep.Cmpsymbolcomparisontable)and27%aminoacidsimilarityfortheentirelengthoftheNodOprotein,ascalculatedbyBESTFIToftheGCGsequenceanalysissoftware(UniversityofWisconsin,Madison).Thehomologywasconcentratedintheareaofresidues700to900ofhemolysin.Figure4showsthealignmentoftheNodOsequencewiththispartofthehemolysinsequence.TranscriptionanalysisofthenodOgene.PromoteractivityofpRLlJIfragmentscontainingportionsofthenodOgenewastestedbycloningfragmentsinfrontofthepromoterlesslacZgeneinpMP220.TheoriginalnodO-containingPstI-BglIIfragmentinpMP454(Fig.1)showednoinduciblepromoteractivityineitherdirection,suggestingthatthisfragmentcontainedacompletetranscriptionalunit.Subse-quently,the0.3-kbPstI-BamHI-fragmentofthisclonecon-tainingthenodboxsequencedescribedaboveandtheadjacentBamHI-BglIIfragmentweresubclonedandtestedforinduciblepromoteractivityinbothdirections.Onlytheformerfragmentshowednaringenin-inducible,nodD-depen-dentpromoteractivitydirectedtowardsthenodOreadingframe(pMP455inFig.1).The1.3-kbBamHI-BglllfragmentinpMP446showedneitherproductionoftheproteinnorinduciblepromoteractivity.Theseresultsindicatethepres-enceofaflavonoid-induciblepromotercontrollingexpres-sionofnodO(transcribedfromlefttorightinFig.1).AlthoughhomologybetweentheconsensussequenceofthenodboxandthepromoterregionofthenodOgenewasfound,thenodboxwaspoorlyconserved.Figure5showsthenodboxofthenodOgene,alignedwiththoseofthenodA,nodF,andnodMgenesofpRLlJIaswellaswiththeconsensussequencedefinedbySpainketal.(27).Tenmismatcheswiththeconsensussequencewerefound,whichismorethaninanyoftheothernodboxsequencesdeter-minedsofar(27).Byusingtheprimerextensionmethod,thetranscriptionstartsiteinthepromoterfragmentwasdetermined;theresultsareshowninFig.6.Transcriptionstarts24basepairsdownstreamofthenodbox,apositionwhichissimilartothatfoundforothernodpromotersofpRLlJI(28),con-firmingthattheidentifiednodboxprecedingnodOisfunc-tional.EffectsofnodDgenecopynumberontranscriptionofnodO.Inourearlierstudieswefoundthat,unlikethewild-typesituationinwhichthesecretedproteinisproducedinverylowamounts,theintroductionofmultiplecopiesofthenodDgeneleadstoincreasedproduction(2).ToassesswhetherthenumberofnodDcopiesaffectsproductionoftheNodOproteinatthetranscriptionallevel,wecomparedtheinduc-tionoftranscriptionofthenodOpromoterwiththatofthenodApromoterofthesameSymplasmid,pRLlJI,bymeasuringtheinductionofP-galactosidaseactivityfrombothpromotersclonedinfrontofapromoterlesslacZgeneintheIncPvectorpMP220.TheconstructionoftheIncPvectorcontainingthenodOpromoterpMP455wasasde-scribedabove.PlasmidpMP240,containingthenodApro-VOL.171,1989 6768DEMAAGDETAL.nodO2NIKGSDNGSFIKGSPENDIIDGGKKNDWIDAGNGDDRIKAGDGQDSITAG51hlyA720ELI4TTRADKFF4SKFAIFHGADGDlHIEGNDGN-DLYGDK4NDTLSG4769nodO52PGHDIVWAGKGSDVIHADGGDDLLYSDASYPLYVTDPHRV...IPHSGEG98hlyA770N4DbQLGDGNIRLIGGA4NNYLNGGDGDDELQVQGNSLKNLSGIKc819nodO99DDVLYAGPGSDILVAGDGADVLTGGDDGDAFVF.....RFHDPMVGTTHC143hlyA820NDKLYGSE6AbLLDGElNDLLK64YGNDISLSGYGHHIIDDDGGKDD869nodO144YTSVMDFDTKQDRFVLDAADFGGDRNLFDANFINHSKGFPGEFVDTFYNG193hlyA870KL1SIDFRDVEGNDLIGNVLSIG4KNlITFKNWFRS4919FIG.4.AlignmentofNodO(topline,residues2to193)andHlyA(bottomline,residues720to919).Identicalandsimilarresiduesareconnectedbyvertic

5 aldashes.Thepairsofsimilarityusedhere(Ia
aldashes.Thepairsofsimilarityusedhere(IandL,VandI,VandL,WandY,FandY,DandE,andKandR)eachhaveascoreof0.8orhigherinthePAM250matrixofDayhoff(1),inwhichidenticalpairseachhaveascoreof1.5.Gapsinthealignedsequencesareindicated().moter,wasdescribedpreviously(3).BothconstructsweretestedinbackgroundswithonenodDgenecopyaswellaswithmultiplenodDgenecopies.Eitherthewild-typecopyinpRLlJI(RBL5560)oranIncQ-nodDclone,pMP468,wasusedasthesourceofnodD.pMP468wasobtainedbycloningthenodD-containingHindIIlfragmentofpMP280intotheIncQvectorpMP77;resultsoftheinductionexper-imentsareshowninTable2.TheinducedactivityofthenodApromoterwasraisedbyonly60%whenthenumberofnodDgenecopieswasincreased.Incontrast,theinducedactivityofthenodOpromoter,whichwasinitiallylowcomparedwiththatofthenodApromoterwithonenodDgenecopy,wasraisedby650%inthepresenceofmultiplenodDgenecopies.TheseresultsshowthatthemaximumactivityofthenodOpromoterisatleastcomparabletothatfoundforthenodApromoter.ExpressionoftheclonednodFandnodMpromotersundersimilarconditionswas,asforthenodApromoter,raisedonlyslightlybyraisingthenumberofnodDgenecopies(datanotshown).TheseresultsclearlyshowthatexpressionofthenodOpromoterhasregulationfeatureswhicharedifferentfromthosedescribedfortheotherknowninduciblenodpromotersofpRLlJI.DISCUSSIONNodOisthestructuralgeneforthesecreted,naringenin-inducible50-kDaprotein.InthisstudywedescribethecloningandanalysisofthestructuralgeneforapreviouslydescribedSymplasmid-dependent,flavonoid-induciblepro-teinofR.leguminosarumbiovarviciae(2).Thisgene,designatednodO,islocatedinanewtranscriptionunitlocatedattheleftofthealreadyidentifiednodgenesofpRLlJI.Itisundertranscriptionalcontrolofasofarunidentifiednodbox.TheregioninwhichthegeneislocatedisidenticaltothelocationofearlieridentifiedTnSinsertionsinmutants,whichcouldnotproducethesecretedprotein(2).ThenodulationlocusnolRdescribedbyEconomouetal.(6)wasalsolocalizedinthisregion.TheexactlocationofthisnolRgene,aswellasitsnucleotidesequence,wasalsorecentlydeterminedbythisgroupandappearedtobeidenticaltonodO(A.W.B.Johnston,personalcommuni-cation).ItisgenerallyacceptednowtonamethegenenodO.PropertiesofthenodOgeneanditsproduct.ThenodOgeneanditsproducthaveanumberofinterestingproperties.First,theNodOproteinisthefirstrhizobialproteinthathasbeenshowntobesecretedintothegrowthmedium.Ingram-negativebacteria,inwhichtheoutermembraneformsanextrabarrierfortheexportofproteinsfromthecytoplasmtotheexterior,severaldifferentmechanismshaveevolvedtoovercomethisproblem(22).Inmostknownexamplesofproteintransportthroughthecytoplasmicmembrane,thepresenceofanN-terminalsignalsequenceisrequiredandexportisfollowedoraccompaniedbyprocessingbyasignalpeptidase.Ourobservationthatthesecretedprotein(NodOprotein)showsnoevidenceofprocessing,aswellasthefactthatnoapparentsignalsequencecouldbefound,suggeststhattheNodOproteinisexportedinanunusualmanner.Althoughuncommon,exportofproteinslackingN-terminalsignalsequencesdoesoccurinE.coli,aswasshownforcolicins(22),hemolysin(8),and,veryrecently,curlin(20).Second,althoughthemolecularsizeoftheNodOproteinwasoriginallyestimatedat50kDabygelelectrophoresis,thetranslatedsequenceoftheopenreadingframeofnodOallowsonlyfortheproductionofaproteinof30kDa.ThereasonforthisextremelyanomalousbehavioroftheNodOproteininelectrophoresisisyetunclear.Possibleexplana-tionsareposttranslationalmodificationoftheproteinorlowsodiumdodecylsulfate-bindingcapacity.Severalpossibili-tiesarecurrentlybeingstudiedinourlaboratory.Third,theregulationofexpressionofthenodOgeneatthetranscriptionallevelappearstobedifferentfromthatofotherinduciblenodgenesinthisspecies.Wehaveshownthat,althoughthemaximallyobservedexpressionlevelofthenodOpromoteristhesameasthatofthenodApromoter,thislevelwasonlyreachedwhenmultiplecopiesofthenodDgenewerepresent.WithonenodDgenecopypresent,theinducednodOpromotershowedonly23%oftheactivityoftheinducednodApromoter.Thisresultmay,atleastpartly,explaintheoverproductionoftheNodOproteinwhenmul-tiplenodDgenecopiesarepresent(2).Thedifferentbehav-iorofthenodOpromotercomparedwiththatofotherpromotersofpRLlJIcouldbecausedbythefactthatthenodboxprecedingnodOispoorlyconserved.Ascouldbeexpected,astrainwithanIncQcloneofnodDformsincreasedamountsofNodDprotein(H.Schlamann,per-sonalcommunication).AlowlevelofNodDproteininthewild-typesituationcouldfavorinductionoftranscriptionofnodAGGGTTGAAnodFnodIfConsensusNodOCGAGCCACrATCCATTCCATAGATGATTGCCATCCAAACMTCAATTTTACCMTCTkATCCATAGTGTGGATGCTTTTGATCCACACMTCMTTTTACCMTGA**TTCGGATCACT1~MACCCGG_AAACTkAGC**TGCCATATGATCCAAGCAGGGCAGGTGGGCGkATC

6 CATATCGT(GGATGATAGCTATCCCAACAATCAATTTTAC
CATATCGT(GGATGATAGCTATCCCAACAATCAATTTTACTMAATC'TTTGGATTTTAcACGCGCTGGYATCCAY..YUYUGATG....Y.ATC.AAACAATCUATTTTACCAATCY1-13bpAT(T)AG----r--------176bptonodA150bptonodF69bptonodMK35bptonodOFIG.5.ComparisonofthenodboxesofnodA,nodF,nodM,andnodOofpRLlJIwiththeconsensussequenceasdefinedbySpainketal.(27).Mismatchesareunderscored.ThetranscriptionstartsitesofthenodA,nodF,andnodOgenesattherightendofthesequenceareindicated(*).Y,Pyrimidine;U,purine.CATTTTC4ATCCGTGAT_CAATAGGTCATATCAAAACAATGGATTTCACTAAT(CTCTTGGAAAAqA!.pZGACAJ.BACTERIOL. nodOENCODESASECRETEDPROTEIN6769GATxA_GI_CI-TTGGAAAT-GGACAC.:AAGATAGGGaGtelFtG.sutrroningtodigsrndsqecofthetranscriptionastrsieondObstartsite(*)isshown.Alsoshownisthelastpartofthenodbox.themoreconservednodpromoters,whilekeepingtranscrip-tionofnodOatarelativelylowlevel.Thiscouldprovidethecellwithamechanismforfine-tuningnodgeneexpression.FunctionofnodOatthemolecularlevel.Atpresent,thefunctionoftheNodOproteinatthemolecularlevel,asformostoftheotheridentifiednodgeneproducts,remainsunknown.AlthoughthehomologywiththehemolysinAproteinissignificant,itdoesnotprovidehardevidenceforTABLE2.ComparisonofinductionofexpressionofthenodAandnodOpromotersindifferentbackgrounds1-Galactosidaseactivity(U,1o-3)inbackground:Promoter(gene)RBL5560LPR5045(pMP468)inducerNaringenininducerNaringeninpMP240(nodA)0.26.80.211.6pMP455(nodO)0.81.60.712.0apMP468istheIncQvectorpMP71containingtheclonednodDgeneofpRLlJI.Naringeninat100nMwasusedastheinducer.thefunctionofNodObecausehemolysinismuchlargerthanNodOprotein(1,023versus284aminoacids)andfunctionalregionsofhemolysinAhavenotbeenidentifiedindetail.However,itisinterestingthathemolysinisalsoasecretedproteinwithoutanN-terminalsignalsequence.TheregionofHlyA,whichishomologoustoNodO,containsatightlyclusteredblockofrepeatsoftheconsensussequenceGGBGBBXLX(16).ItwassuggestedthatinHlyA,thisblockmayformanimportantstructuraldomainseparatingtheN-terminaltoxinpartofthemoleculefromtheC-terminalsecretorydomain.WhetherNodOhasasimilardomainstructureremainstobedetermined.NodOproteinmayhavetwofunctions,asitwasshownbyEconomouetal.thatmutationofthenodOgeneaffectsexpressionoftherhiAproduct(6),whichislocatedinthecytoplasm(3).Thisinitiallyseemsinconsistentwiththeextracellularlocaliza-tionofNodOproteinandrequiresfurtherstudy.Theextra-cellularNodOproteinmayhavesomefunctioninthecom-municationbetweenthebacteriumanditshostplant,possiblythroughinteractionwiththehostplantcellsurface.ACKNOWLEDGMENTSJ.Ruiz-SainzissupportedbyfellowshipBAP-0522-NLofthebiotechnologyprogramoftheCommissionoftheEuropeanCom-munity.WethankPieterD.WassenaarandJ.H.BrouwershavenoftheUnileverResearchLaboratory,Vlaardingen,TheNetherlands,forperformingtheaminoacidsequencingandJohnM.A.Verbakelforhelpfuldiscussions.LITERATURECITED1.Dayhoff,M.1978.Atlasofproteinsequenceandstructure.NationalBiomedicalResearchFoundation,SilverSpring,Md.2.DeMaagd,R.A.,H.P.Spaink,E.Pees,I.H.M.Mulders,A.WiJfjes,C.A.WUffelman,R.J.H.Okker,andB.J.J.Lugten-berg.1989.LocalizationandsymbioticfunctionofaregionontheRhizobiumleguminosarumSymplasmidpRLlJIresponsi-bleforasecreted,flavonoid-inducible50-kilodaltonprotein.J.Bacteriol.171:1151-1157.3.DeMaagd,R.A.,C.A.Wijffelman,E.Pees,andB.J.J.Lugtenberg.1988.DetectionandsubcellularlocalizationoftwoSymplasmid-dependentproteinsofRhizobiumleguminosarumbiovarviciae.J.Bacteriol.170:44244427.4.Ditta,G.,S.Stanfield,D.Corbin,andD.R.Helinski.1980.Broadhost-rangeDNAcloningsystemforgram-negativebac-teria:constructionofagenebankofRhizobiummeliloti.Proc.Natl.Acad.Sci.USA77:7347-7351.5.Downie,J.A.,Q.S.Ma,C.D.Knight,G.Hombrecher,andA.W.B.Johnston.1983.CloningofthesymbioticregionofRhizobiumleguminosarum:thenodulationgenesarebetweenthenitrogenaseandanifA-likegene.EMBOJ.2:947-952.6.Economou,A.,F.K.L.Hawkins,J.A.Downie,andA.W.B.Johnston.1989.TranscriptionofrhiA,ageneonaRhizobiumleguminosarumbv.viciaeSymplasmid,requiresrhiRandisrepressedbyflavanoidsthatinducenodgenes.Mol.Microbiol.3:87-93.7.Engelman,D.M.,T.A.Steitz,andA.Goldman.1986.Identify-ingnonpolartransbilayerhelicesinaminoacidsequencesofmembraneproteins.Annu.Rev.Biophys.Biophys.Chem.15:321-353.8.Felmlee,T.,S.Pellett,E.-Y.Lee,andR.A.Welch.1985.Escherichiacolihemolysinisreleasedextracellularlywithoutcleavageofasignalpeptide.J.Bacteriol.163:88-93.9.Felmlee,T.,S.Pellett,andR.A.Welch.1985.NucleotidesequenceofanEscherichiacolichromosomalhemolysin.J.Bacteriol.163:94-105.10.Firmin,J.L.,K.E.Wilson,L.Rossen,andA.W.B.Johnston.1986.FlavonoidactivationofnodulationgenesinRhizobiumreversedbyothercompoundspresentinpla

7 nts.Nature(Lon-don)324:90-92.VOL.171,198
nts.Nature(Lon-don)324:90-92.VOL.171,1989 6770DEMAAGDETAL.11.Hombrecher,G.,N.J.Brewin,andA.W.B.Johnston.1981.LinkageofgenesfornitrogenaseandnodulationabilityonplasmidsinRhizobiumleguminosarumandRhizobiumphaseoli.Mol.Gen.Genet.182:133-136.12.Hooykaas,P.J.J.,P.M.Klapwik,M.P.Nuti,R.A.Schilp-eroort,andA.Rorsch.1977.TransferoftheAgrobacteriumTiplasmidtoavirulentagrobacteriaandtorhizobiaexplanta.J.Gen.Microbiol.98:477-484.13.Hooykaas,P.J.J.,F.G.M.Schnidewindt,andR.A.Schilp-eroort.1982.IdentificationoftheSymplasmidofRhizobiumleguminosarumstrain1001anditstransfertoandexpressioninotherRhizobiaandAgrobacteriumtumefaciens.Plasmid8:73-82.14.Johnston,A.W.B.,J.L.Beynon,A.V.Buchanon-Woilaston,S.M.Setcheil,P.R.Hirsch,andJ.E.Beringer.1978.HighfrequencytransferofnodulationabilitybetweenstrainsandspeciesofRhizobium.Nature(London)276:634-636.15.Kieny,M.P.,R.Lathe,andJ.P.Lecocq.1983.NewversatilecloningandsequencingvectorsbasedonbacteriophageM13.Gene26:91-99.16.Mgckman,N.,K.Baker,L.Gray,R.Haigh,J.-M.Nicaud,andI.B.Holland.1987.ReleaseofachimericproteinintothemediumfromEscherichiacoliusingtheC-terminalsecretionsignalofhaemolysin.EMBOJ.6:2835-2841.17.Maniatis,T.,E.F.Fritsch,andJ.Sambrook.1982.Molecularcloning:alaboratorymanual.ColdSpringHarborLaboratory,ColdSpringHarbor,NewYork.18.Marsh,J.L.,M.Erfle,andE.J.Wykes.1984.ThepICplasmidandphagevectorswithversatilecloningsitesforrecombinantselectionbyinsertionalinactivation.Gene32:481-485.19.Mulligan,J.T.,andS.R.Long.1985.InductionofRhizobiummelilotinodCexpressionbyplantrootexudaterequiresnodD.Proc.Natl.Acad.Sci.USA82:6609-6613.20.Olsen,A.,A.Jonsson,andS.Normark.1989.FibronectinbindingmediatedbyanovelclassofsurfaceorganellesonEscherichiacoli.Nature(London)338:652-655.21.Peters,N.K.,J.W.Frost,andS.R.Long.1986.Aplantflavone,luteolin,inducesexpressionofRhizobiummelilotigenes.Sci-ence233:977-980.22.Pugsley,A.P.,andM.Schwartz.1985.Exportandsecretionofproteinsbybacteria.FEMSMicrobiol.Rev.32:3-38.23.Redmond,J.W.,M.Batley,M.A.Djordjevic,R.W.Innes,P.L.Kuempel,andB.G.Rolfe.1986.Flavonesinduceexpres-sionofnodulationgenesinRhizobium.Nature(London)323:632-635.24.Rossen,L.,C.A.Shearman,A.W.B.Johnston,andJ.A.Downie.1985.ThenodDgeneofRhizobiumleguminosarumisautoregulatoryandinthepresenceofplantexudateinducesthenodA,B,Cgenes.EMBOJ.4:3369-3373.25.Rostas,K.,E.Kondorosi,B.Horvath,A.Simoncsits,andA.Kondorosi.1986.ConservationofextendedpromoterregionsofnodulationgenesinRhizobium.Proc.Natl.Acad.Sci.USA83:1757-1761.26.Sanger,F.,S.Nicklen,andA.R.Coulson.1977.DNAsequenc-ingwithchain-terminatinginhibitors.Proc.Natl.Acad.Sci.USA74:5463-5467.27.Spaink,H.P.,R.J.H.Okker,C.A.Wijffelman,E.Pees,andB.J.J.LugtenbWrg.1987.PromotersinthenodulationregionoftheRhizobiumleguminosarumSymplasmidpRLlJI.PlantMol.Biol.9:27-39.28.Spaink,H.P.,R.J.H.Okker,C.A.Wjffelman,T.Tak,L.Goosen-deRoo,E.Pees,A.A.N.VanBrussel,andB.J.J.Lugtenberg.1989.Symbioticpropertiesofrhizobiacontainingaflavonoid-independenthybridnodDproduct.J.Bacteriol.171:4045-4053.29.Spaink,H.P.,C.A.Wiffehnan,R.J.H.Okker,andB.J.J.Lugtenberg.1989.LocalizationoffunctionalregionsoftheRhizobiumnodDproductusinghybridnodDgenes.PlantMol.Biol.12:59-73.30.Spaink,H.P.,C.A.W"ffelman,E.Pees,R.J.H.Okker,andB.J.J.Lugtenberg.1987.RhizobiumnodulationgenenodDasadeterminantofhostspecificity.Nature(London)328:337-340.31.VanSlogteren,G.M.S.,J.H.C.Hoge,P.J.J.Hooykaas,andR.A.Schilperoort.1983.Clonalanalysisofheterogenouscrowngalltumourtissuesinducedbywild-typeandshootermutantstrainsofAgrobacteriumtumefaciens:expressionofT-DNAgenes.PlantMol.Biol.2:321-333.32.Vincent,J.M.1980.Factorscontrollingthelegume-Rhizobiumsymbiosis,p.103-129.InW.E.NewtonandW.H.Orme-Johnson(ed.),Nitrogenfixation.UniversityParkPress,Balti-more.33.VonHeine,G.1986.Anewmethodforpredictingsignalsequencecleavagesites.NucleicAcidsRes.14:4683-4690.34.WUffehnan,C.A.,E.Pees,A.A.N.VanBrussel,R.J.H.Okker,andB.J.J.Lugtenberg.1985.GeneticandfunctionalanalysisofthenodulationregionoftheRhizobiumleguminosa-rumSymplasmidpRl1JI.Arch.Microbiol.143:225-232.35.Wiffelman,C.A.,B.Zaat,H.Spaiink,I.Mulders,A.A.N.VanBrussel,R.Okker,R.DeMaagd,andB.J.J.Lugtenberg.1986.InductionofRhizobiumnodgenesbyflavonoids:differentialadaptationofpromoter,nodDgeneandinducersforvariouscross-inoculationgroups,p.123-135.InB.Lugtenberg(ed.),Recognitioninmicrobe-plantsymbioticandpathogenicinterac-tions.Springer-VerlagKG,Berlin.36.Yanisch-Perron,C.,J.Vieira,andJ.Messing.1985.ImprovedM13phagecloningvectorsandhoststrains:nucleotidese-quencesoftheM13mpl8andpUCvectors.Gene33:103-119.J.BACT