Upload
Featured Recent Articles Topics Login Upload

Search Results for ''

published presentations and documents on DocSlides.

Multiple alignment The linear comparison of more than two sequences
Multiple alignment The linear comparison of more than two sequences
by natalia-silvester
Places residues in columns . per . position sp...
DNA Sequences Analysis Hasan
DNA Sequences Analysis Hasan
by angelina
Alshahrani. CS6800. Statistical Background : HM...
MCB 3421 Class 13 Multiple sequence alignment
MCB 3421 Class 13 Multiple sequence alignment
by sadie
the role of gene duplication followed by loss of f...
Overview of Multiple Sequence Alignment Algorithms
Overview of Multiple Sequence Alignment Algorithms
by davis
Yu He. 04/13/2016. Adapted from the multiple seque...
Sequence Alignment Abhishek
Sequence Alignment Abhishek
by tabitha
Niroula. Department of Experimental Medical Scienc...
Homologues finding and Multiple Sequence Alignment
Homologues finding and Multiple Sequence Alignment
by liane-varnes
Maya Schushan. November 2010. Outline- introducti...
Multiple alignment
Multiple alignment
by yoshiko-marsland
The linear comparison of more than two sequence...
New Multiple Sequence Alignment Methods
New Multiple Sequence Alignment Methods
by alida-meadow
Tandy Warnow. The Department of Computer Science....
1 Introduction to Sequence Analysis
1 Introduction to Sequence Analysis
by luanne-stotts
Utah State University – Spring . 2012. STAT 557...
Ultra
Ultra
by briana-ranney
-large . Multiple Sequence Alignment. Tandy Warno...
Previous Lecture
Previous Lecture
by sherrill-nordquist
Hypothesis Tesing 2: Comparing Samples. Multiple ...
TIPP: Taxon Identification and Phylogenetic Profiling
TIPP: Taxon Identification and Phylogenetic Profiling
by tatiana-dople
Tandy Warnow. The Department of Computer Science....
Phylogenomics Symposium
Phylogenomics Symposium
by conchita-marotz
and Software School. Tandy Warnow. Departments of...
Previous Lecture:
Previous Lecture:
by liane-varnes
Probability. Introduction to Biostatistics and Bi...
Last lecture summary
Last lecture summary
by yoshiko-marsland
identity vs. similarity. homology vs. similarity....
1 Introduction to Sequence Analysis
1 Introduction to Sequence Analysis
by stefany-barnette
Utah State University – Spring . 2012. STAT 557...
BIO 508
BIO 508
by phoebe-click
Comparative Genomics. Eric Franzosa, PhD. 2 April...
Multiple Sequence Alignments
Multiple Sequence Alignments
by min-jolicoeur
and Sequence Profiles. Multiple sequence alignmen...
BLAST and Database Searches
BLAST and Database Searches
by min-jolicoeur
Mohammed Mehdi Rizvi. Molecular Lab Techniques 44...
MAFFT:
MAFFT:
by lois-ondreau
Multiple Sequence Alignment using Fast Fourier Tr...
Database search
Database search
by myesha-ticknor
and . pairwise. alignments. 1. “. It is a capi...
Last lecture summary Flavors of sequence alignment
Last lecture summary Flavors of sequence alignment
by elina
pair-wise alignment. × . multiple . sequence . a...
How To Blast David A. Kloske
How To Blast David A. Kloske
by liane-varnes
Thermo Fisher / Open Biosystems. Dr. Krishnan K. ...
)6 Introduction ! INFO http://en.wikipedia.org/wiki/ /Evolution,
)6 Introduction ! INFO http://en.wikipedia.org/wiki/ /Evolution,
by angelina
)7 Quoting from the web site http://www.megasof...
Protein function and classification
Protein function and classification
by hadley
Hsin. -Yu Chang. www.ebi.ac.uk. Classifying . prot...
Data bases ( Biosequences, Structures, Genomes, DNA Chips, Proteomics, Interactomics
Data bases ( Biosequences, Structures, Genomes, DNA Chips, Proteomics, Interactomics
by isabella
). Design. Curation. Data Mining. Computational Bi...
Previous Lecture: Probability
Previous Lecture: Probability
by reese
Introduction to Biostatistics and Bioinformatics. ...
Sequence alignments 2: Dynamic programming and an exercise
Sequence alignments 2: Dynamic programming and an exercise
by claire
Hardison. Genomics 4_2. Sources: Webb Miller (Penn...
Scaling BAli-Phy to Large Datasets
Scaling BAli-Phy to Large Datasets
by tatyana-admore
June 16, 2016. Michael Nute. 1. BAli-Phy: Brief S...
Sequence Alignment
Sequence Alignment
by luanne-stotts
Xuhua Xia. xxia@uottawa.ca. http://dambe.bio.uott...
Multiple Sequence Alignment
Multiple Sequence Alignment
by test
Scott Walmsley, PhD. Research Instructor, Departm...
Multiple sequence alignment methods: evidence from data
Multiple sequence alignment methods: evidence from data
by danika-pritchard
CS/. BioE. 598. Tandy Warnow. Alignment Error/Ac...
Sequence Alignment
Sequence Alignment
by calandra-battersby
Xuhua Xia. xxia@uottawa.ca. http://dambe.bio.uott...
Multiple Sequence Alignment
Multiple Sequence Alignment
by alexa-scheidler
with. PASTA. Michael Nute. Austin, TX. June 17, 2...
Alignment & Secondary Structure
Alignment & Secondary Structure
by conchita-marotz
. You have learned about:. Data & databases....
Pairwise Sequence Alignment
Pairwise Sequence Alignment
by yoshiko-marsland
BMI 877. Colin Dewey. colin.dewey@wisc.edu. March...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by luanne-stotts
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
MCB 5472
MCB 5472
by conchita-marotz
Blast, Psi BLAST, . Perl: Arrays, Loops . J. Pete...
Last lecture summary
Last lecture summary
by briana-ranney
Sequencing strategies. Hierarchical genome shotgu...
Phylogenetic
Phylogenetic
by jane-oiler
Tools. Tara and . Pawel. Concept Map. Start with...