PPT-Web Databases for Drosophila
Author : fauna | Published Date : 2022-06-11
An introduction to web tools databases and NCBI BLAST Wilson Leung 122021 Agenda GEP annotation project overview Web databases for Drosophila annotation UCSC Genome
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Web Databases for Drosophila" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Web Databases for Drosophila: Transcript
An introduction to web tools databases and NCBI BLAST Wilson Leung 122021 Agenda GEP annotation project overview Web databases for Drosophila annotation UCSC Genome Browser NCBI BLAST. Seminar: Transaction Processing (Bachelor). SS 2009. Dennis . Stratmann. Outline. Goal and Overview. Examine Three Approaches to CC on RD:. 1. Predicate-Oriented Concurrency Control. 2. Relational Update Transactions. Frederic Murray. Assistant Professor . MLIS, University of British Columbia. BA, Political Science, University of Iowa. . Instructional Services Librarian. Al Harris Library . frederic.murray@swosu.edu. BTEC Applied Science. Unit 18: Genetics. Assignment 3: Inheritance. Starter Quiz. For Each question, write down the answer in your notes…. Question 1:. Which is the Male fly?. A. B. Question 2. What mutation is this fly displaying?. DATABASES. What do you think the word Database means?. DEFINITION:. A database is a collection of data or. information which is stored in a . logical and . structured way. Paper Based Databases. Paper Based Databases. ABSTRACT Function in Drosophila melanogaster Duke University Date:_______________________ Approved: ___________________________ Daniel P. Kiehart, Supervisor ___________________________ Daniel J. Lew What are databases?. Databases are a collection tables that are searchable. These databases are filled with periodical materials (newspapers, journals, magazines, and even blog posts). These databases prevent you from having to go from journal to journal by hand. ~Max Frisch. (Swiss playwright, novelist, philosopher, social critic). Contents. Citing Databases. General Info. MLA. APA. Visuals—Internal Citations. MLA. APA. Visuals—Bibliographic Citations. MLA. . SYFTET. Göteborgs universitet ska skapa en modern, lättanvänd och . effektiv webbmiljö med fokus på användarnas förväntningar.. 1. ETT UNIVERSITET – EN GEMENSAM WEBB. Innehåll som är intressant för de prioriterade målgrupperna samlas på ett ställe till exempel:. Orb2 dependent . long-term memory maintenance in Drosophila . Natalie . Galles. S. N. Bose Research Exchange. Summer 2016. Lab 11 . nccs. – . pune. Internship at NCCS, Pune. Spent my 8 weeks working in Lab 11 under direction of Dr. . protein content has also been found to aect lifespan 23], and this would be increased following a heavy probiotic diet. Furthermore, increased expression of antioxidant enzymes (superoxide dismutase ADRC 2014, San Diego. In this talk….. Why human disease models?. The data so far. Searching human disease model data. What’s next?. . 1993. 1998. 2003. 2008. 2013. Drosophila papers containing “disease” in the abstract or title. Drosophila . melanogaster. Drosophila Melanogaster, a popular genetic model organism. ~ 50% of fly genes have vertebrate homologs. Small and easy to grow in lab. Short generation time . Produce high amounts of offspring. . Phylogenetic relationships and estimated divergence times of major lineages in the genus Drosophila. Taxa in bold are pr 2606 frame (ORF) was cloned into the I site of pAc5.1/c-MYC-HISAusing the following PCR primers: AcCYLD-F: 5-CCCGAATTCC A -AAATGATCTTAAACAACAA AAG TAAAAC-3CCCCTCGAGATGGTACATCATTA TATCTGTGC-3MYC-HIS A
Download Document
Here is the link to download the presentation.
"Web Databases for Drosophila"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
