PPT-Techniques for MSA
Author : giovanna-bartolotta | Published Date : 2017-12-16
Tandy Warnow Multiple Sequence Alignment MSA another grand challenge 1 S1 AGGCTATCACCTGACCTCCA S2 TAGCTATCACGACCGC S3 TAGCTGACCGC Sn TCACGACCGACA
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Techniques for MSA" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Techniques for MSA: Transcript
Tandy Warnow Multiple Sequence Alignment MSA another grand challenge 1 S1 AGGCTATCACCTGACCTCCA S2 TAGCTATCACGACCGC S3 TAGCTGACCGC Sn TCACGACCGACA. Same Picture – . Different Feeling Evoked?. The Media is Powerful. Propaganda Techniques. What is propaganda?. Propaganda is a way of . manipulating . people using . images and words . to achieve a desired affect or outcome.. - Drawings must be 3D . -Use wire frames to make 3D crates. - Add . colour. and tone – but less is more. Remember the light source will come from one direction. -Add thick and thin lines to show depth.. RECORDINGMICROPHONE TECHNIQUES 3 Microphone Techniques.............4..................................................................................5Microphone Techniques ........................... Surreal Techniques. Objective: You will describe and define . surreal techniques in order to apply them. to your surreal artwork.. Drill :. Draw this table in your sketchbook:. Techniques Definition Idea for mine. for . generating. . ideas. Image. : fotographic1980 / FreeDigitalPhotos.net. “Creativity as a process of becoming sensitive to problems, deficiencies, gaps in knowledge, missing elements, disharmonies, and so on; identifying the difficulty; searching for solutions, making guesses, or formulating hypotheses about the deficiencies: testing and retesting these hypotheses and possibly modifying and retesting them; and finally communicating the results.”. AFOREST persuasive. techniques. This lesson we will:. Mind-map where we might find persuasive techniques. . Read about some persuasive techniques.. Complete a matching activity.. Where might we find persuasive techniques?. The Product and Quotient Rules. OBJECTIVE. Differentiate using the Product and the Quotient Rules.. Use the Quotient Rule to differentiate the average cost, revenue, and profit functions.. . THEOREM 5: The Product Rule. Junior Cert Poetry . Poetic terms/Techniques . Speaker/ person. : the voice in the poem. This is usually but not always the voice of the poet. . Title:. name of the poem . Tone/Mood. : how the poet feels about what she/he is writing (joyful, angry, bitter, self-pity etc.). ITIP. United States Soccer Federation. Lesson Set. Think about previous classes that you’ve attended. . Were questions asked by the students? And were responses given?. Did the instructor ask questions and seek responses? A coincidence?. A major way to break the chain of infection is to use aseptic techniques while providing health care.. Asepsis. =absence of disease-producing microorganisms (pathogens). Sterile. =free from all organisms, both pathogens & . Design and Modeling. Common Uses of Sketching . Brainstorm. Communicate. Document. Advantages of Hand Sketching. Convenient. Inexpensive. Sketching Techniques. Lines. Vertical Line. Horizontal Line. Created by Ashley Berryhill. Adapted by Dana Cashion. Aseptic techniques. A major way to break the chain of infection is to use aseptic techniques while providing health care.. Asepsis. =absence of disease-producing microorganisms (pathogens). 5 Research-ByEdward KangToo often people imagine that long hours of studying are the best path to being a model straight-A student Yetresearch showsthat highly successful students actually spend less Emotional Freedom Technique – Tapping. Emotional Freedom Technique (EFT) - Tapping. EFT tapping has roots in the 1970s when several doctors began stimulating acupressure points to help their patients deal with stress, fear, and phobias. One of them, patented by Dr. Roger Callahan, is called Thought Field Therapy. Later Gary Craig simplified the process and made it available to the public under the EFT name. EFT falls into the category of “body-centered therapies”..
Download Document
Here is the link to download the presentation.
"Techniques for MSA"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents