DocSlides

PPT-Techniques for MSA

SO

giovanna-bartolotta

Published 2017-12-16 | 5454 Views

Techniques for MSA
Tandy Warnow Multiple Sequence Alignment MSA another grand challenge 1 S1 AGGCTATCACCTGACCTCCA S2 TAGCTATCACGACCGC S3 TAGCTGACCGC Sn TCACGACCGACA

Download Presentation

Download Presentation The PPT/PDF document "Techniques for MSA" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Presentation Transcript