/
Supplementary Figure 1 Coding or noncoding targeting depends on the E Supplementary Figure 1 Coding or noncoding targeting depends on the E

Supplementary Figure 1 Coding or noncoding targeting depends on the E - PowerPoint Presentation

leah
leah . @leah
Follow
345 views
Uploaded On

Supplementary Figure 1 Coding or noncoding targeting depends on the E - PPT Presentation

The percentages of EGFP cells in populations of ABEtreated EGFPPTCKI cells Each experiment was repeated 3 times 0 KI cells Each experiment was repeated 3 tim ID: 853881

jkllj ghij x0000 78179 ghij jkllj 78179 x0000 egfp gctcttccgatct cells gggccttaaatgtcacacagag target repeated times 78479 abe experiment ghijkllj123jr

Share:

Link:

Embed:

Download Presentation from below link

Download The PPT/PDF document "Supplementary Figure 1 Coding or noncodi..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript
Supplementary Figure 1 Coding or noncoding targeting depends on the E - pdf download. The percentages of EGFP cells in populations of ABEtreated EGFPPTCKI cells Each experiment was repeated 3 times 0 KI cells Each experiment was repeated 3 tim ID: 853881.. https://www.docslides.com/slides/supplementary-figure-1-coding-or-noncoding-targeting-depends-on-the-e.html