Genetic Approaches to Rare Diseases: - PowerPoint Presentation

440 views
Uploaded On 2016-07-10

Genetic Approaches to Rare Diseases: - PPT Presentation

What has worked and what may work for AHC Erin L Heinzen PharmD PhD Center for Human Genome Variation Duke University School of Medicine July 22 2011 eheinzendukeedu EPILEPSY DISORDERS ID: 399123

genome sequencing disease gtcagtctttaaagtcccgaattcgcccagggtcagtctttaaagtcccgaattcgcccagggtcagtctttaaagtcccgaattcgcccagggtcagtctttaaagtcc sequencing genome gtcagtctttaaagtcccgaattcgcccagggtcagtctttaaagtcccgaattcgcccagggtcagtctttaaagtcccgaattcgcccagggtcagtctttaaagtcc disease variants mutations generation rare genetic responsible exome causing ahc sequence variant

Link:

Copy

Embed:

<iframe width="560" height="315" src="https://www.docslides.com/embed/399123" frameborder="0" allowfullscreen></iframe>

Download Presentation from below link

Download Presentation The PPT/PDF document "Genetic Approaches to Rare Diseases:" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.