PPT- Marker name
SNP or ploymorphism source Marker type Forward primer 1 Forward primer 2 Reverse primer M1 Ebmac0415 SSR GAAACCCATCATAGCAGC AAACAGCAGCAAGAGGAG M2 HVM54 SSR AACCCAGTAACACCGTCCTG
Download Presentation
" Marker name" is the property of its rightful owner. Permission is granted to download and print materials on this website for personal, non-commercial use only, provided you retain all copyright notices. By downloading content from our website, you accept the terms of this agreement. Download
Presentation Transcript
Transcript not available.