PPT- Marker name
SO
brooke
Published 2024-03-13 | 1484 Views
SNP or ploymorphism source Marker type Forward primer 1 Forward primer 2 Reverse primer M1 Ebmac0415 SSR GAAACCCATCATAGCAGC AAACAGCAGCAAGAGGAG M2 HVM54 SSR AACCCAGTAACACCGTCCTG
Download Presentation
Download Presentation The PPT/PDF document " Marker name" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.