Download PPT

PPT-            Marker name

Author : brooke | Published Date : 2024-03-13

SNP or ploymorphism source Marker type Forward primer 1 Forward primer 2 Reverse primer M1 Ebmac0415 SSR GAAACCCATCATAGCAGC AAACAGCAGCAAGAGGAG M2 HVM54 SSR AACCCAGTAACACCGTCCTG

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "            Marker name" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

            Marker name: Transcript


Download Rules Of Document


"            Marker name"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents