PPT-            Marker name

PPT-            Marker name thumbnail
SNP or ploymorphism source Marker type Forward primer 1 Forward primer 2 Reverse primer M1 Ebmac0415 SSR GAAACCCATCATAGCAGC AAACAGCAGCAAGAGGAG M2 HVM54 SSR AACCCAGTAACACCGTCCTG

Download Presentation

"            Marker name" is the property of its rightful owner. Permission is granted to download and print materials on this website for personal, non-commercial use only, provided you retain all copyright notices. By downloading content from our website, you accept the terms of this agreement. Download

Presentation Transcript

Transcript not available.

Related Topics