PPT-Using Golden Gate Assembly to Test Bacterial Promoter Hypot

GCAT Synthetic Biology Workshop 2014 Annealed oligos GGA with Annealed Oligos Sticky End Sticky End Product BsaI BsaI GFP RFP GFP RFP Destination plasmid Anneal Oligos Mix oligos. U6 promoter U6 promoter Ts U6 promoter Ts So far, PCR hairpin primers have performed flawlessly in PCR reactions (n~100)and subsequent cloning. Of the bacterial clones which digest properly (20-100%) The Golden Gate Bridge . Golden Gate bridge history. The Golden Gate Bridge is a suspension bridge spanning the Golden Gate, the opening of the San Francisco Bay into the Pacific Ocean. As part of both U.S. Route 101 and California State Route 1, the structure links the city of San Francisco, on the northern tip of the San Francisco Peninsula, to Marin County. It is one of the most internationally recognized symbols of San Francisco, California, and of the United States. It has been declared one of the modern Wonders of the World by the American Society of Civil Engineers. The . QC Testing. Bacterial . Endotoxins. STOP. Bacterial Endotoxins. All the pharmacopeia require . that . radiopharmaceuticals intended for . intravenous administration must be tested to . ensure that the . U6 promoter U6 promoter Ts U6 promoter Ts So far, PCR hairpin primers have performed flawlessly in PCR reactions (n~100)and subsequent cloning. Of the bacterial clones which digest properly (20-100%) Mallorey Blake, Jaclyn Bates, Danielle Reagan . Prehistory. 3,000 . BC: . The first inhabitants of San Francisco are discovered. 16. th. . century: . Yelamu. tribe lives here. 1769. : Westerners part of the Portola expedition stumble upon the . GATE 5 GATE 6 GATE 4 GATE 3 GATE 2 GATE 1 GATE 3 NOTAN EXIT GATE 1 NOTAN EXIT ARROWHEADSTADIUM AGENERALMPREMIUMJ RVEDHRVEDA RVEDBM RVEDPREMIUMCGDGEGFGGGNGLGBGENERAL(TAILGATE LOT) 2015 KANSAS CITY ROY Expression. MBIOL 6640. 10:45-11:35 ASB 210. Course director:. Dean Tantin, PhD. X7-3035, . dean.tantin@path.utah.edu. Lecture 0. For many of you this is a review of undergraduate material, but . study. Child Care Provider Presentation . Working together to raise awareness and save lives. . 1. 100% Preventable. 2. “This would never happen to me” however this tragedy can happen to anyone!. 81% of the cases are unintentional . NXP Semiconductors. Presenter: Don O’Riordan, Cadence. Analog Fault Sensitivity Analysis (FSA) in SPECTRE. Agenda. Background. Approach. Results. Conclusion. Acknowledgements & References. 2. Background. at CHARM. Christophe Godichal – BE/BI/QP. c. hristophe.godichal@cern.ch. 1. Test Setup. . . . . 2. Test Setup. 40 . GBTx. . Elinks. . . 80 . lines. in the FPGA. Park rangers are trained and equipped to give first aid. Assistance may also be obtained at the Visitors Center. Cell phone and internet coverage in the park area is very limited and unreliable. P Taketa PNAS 2008. Hulled phenotype controlled by one gene: NUD. >NUD_CDS. ATGGTACAGTCCAAGAAGAAGTTTCGCGGCGTCAGGCAGCGCCACTGGGGCTCCTGGGTCTCCGAGATCAGGCATCCTCTCCTAAGAGGAGGGTGTGGTTGGGCACCTTTGAGACGGCGGAGGAGGCTGCGCGGGCGTACGATGAGGCTGCCATCCTGATGAGCGGGCGCAACGCCAAGACCAACTTCCCCGTACCGAGGAGTGCCAACGGGGAGATCATCGTCGCCCCAGCAGCAGCAGCACGGGACATTCGCGGTGGCGTTGGCTCGTCGTCCTCCGGGGCCGCCGGCGCCAGCAGCCTGTCACAGATCCTCAGCGCCAAGCTCCGCAAGTGCTGCAAGACACCGTCCCCGTCCCTCACCTGCCTCCGCCTCGACACCGAGAAGTCCCACATTGGCGTCTGGCAGAAGCGCGCGGGTGCCCGTGCCGACTCCAGCTGGGTCATGACCGTCGAGCTCAACAAGGAGCCGGCCGCAGCGGCACCACCAACGCCCAGCGACAGCACGGTGTCGGCGACTCCTTCCTCGTCCACGTCCACGTCCACAACGGGCTCCCCACCGGAGGCAATGGAGGACGAAGAGAGGATCGCGCTGCAGATGATAGAGGAGCTGCTGAGCAGGAGCAGCCCGGCTTCGCCGTCACATGGGCTGCTGCACGGTGAAGAAGGCAGCCTCCTCATCTGA. Geant4. Geant4 and GATE . releases. Geant4 version. Date release. CLHEP version. Gcc. version. 10.2. 12/2015. 2.2.0.4. 4.8 to 5.2. 10.3. 12/2016. 2.3.4.3. 4.8 to 6.2. GATE v8.0. : . current GATE release from . Culture Test. What is Bacterial culture. Culture media . :. Is a method of multiplying microbial organisms by letting them produce in culture media under controlled laboratory conditions . . Bacteria like any living cell they need organic and inorganic materials for their live(water, .