Their high mutation rate provides the basis for the successful use of microsatellites as genetic markers Exceptionally long microsatellites have been found to be associated with certain human genetic diseases Introduction Tandemly repeated short seq ID: 23148
Download Pdf The PPT/PDF document "Microsatellite Instability Christian Sch..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
MicrosatelliteInstabilityChristianSchloVeterinaryUniversityofVienna,Vienna,AustriaBettinaHarr,VeterinaryUniversityofVienna,Vienna,AustriaMicrosatellitesareaubiquitouscomponentofthegenomeofhigherorganisms.Theirhighmutationrateprovidesthebasisforthesuccessfuluseofmicrosatellitesasgeneticmarkers.Exceptionallylongmicrosatelliteshavebeenfoundtobeassociatedwithcertainhumangeneticdiseases. ArticleContents Introductoryarticle GenomicDistributionMutationalProcessandRatesFactorsDeterminingMicrosatelliteStabilityExpandedTrinucleotideRepeatsASpecialClassofPhenotypicConsequencesofMicrosatellite ENCYCLOPEDIAOFLIFESCIENCES/2001NaturePublishingGroup/www.els.net MutationalProcessandRates$' - $# + ' 4 # Figure2 5 , # ' 4 # Figure2 + # ' 4 ' .# ) $ ' # ' &$ ' $ ! #! , $ # .# , $ ** #' ' ' 7 # , ' ,.# ' , $ #' 2 , # # , # # $# CTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGACGAC CTG CTGCTGCTGCTGCTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGACGAC CTGCTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGACGAC CTGCTGCTGCTGCTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGACGAC CTG CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGACGACGAC +DNA slippage CTGCTGCTGCTGCTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGACGAC CTGCTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGACGAC CTGCTGCTGCTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGAC GAC CTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGAC GAC CTG CTGCTGCTGCTGCTGCTGCTGCTGCTG GACGACGACGACGACGACGACGACGAC Figure2Modelofdeoxyribonucleicacid(DNA)slippage,(a)addingor(b)removingonerepeatunit.(1)FirstroundofDNAreplication.(2)DNAslippage,causingonerepeatunittoloopout(thedirectionofDNAslippageisindicatedingreen).(3)DNAsynthesiscontinueswithoutrepairofthel(4)SecondroundofDNAreplicationleadstoadditionordeletionofonerepeatunitinoneoftheDNAstrands. MicrosatelliteInstabilityENCYCLOPEDIAOFLIFESCIENCES/2001NaturePublishingGroup/www.els.net FactorsDeterminingMicrosatellite( , , 1 # 4 1 ( 4 +' &3# 8 #$# $ $ ,1 - 23 , $ExpandedTrinucleotideRepeatsSpecialClassofMicrosatellites?!, , + ,# , # % 3 +, ' , 9Figure3 ' ' )/0/) )//0/)) .# # - /0) ' :* #:*;* )/0/) /, , ' # 4 ) # ' , $ % # ' 4 1 $# ', # ' 4 ' 5, # ,, ' 4 # #,, Figure3 .# ,, ;=-;Ɖ.;က % # ', # 1 4 343 #2 87 , ; ' ; ' 343 " ,' 343 $ 87' 1, , , Figure4PhenotypicConsequencesofMicrosatelliteExpansions+' , $7 # ', # $ (4) (3) (2) (1) Figure3Deoxyribonucleicacid(DNA)slippagemodelfortheexpansionofatrinucleotiderepeat.(1)FirstroundofDNAreplication.(2)TransientdissociationofDNAstrands.(3)DNAslippageandhairpinformation.(4)DNAreplicationcontinues.(5)ExpandedrepeataftersecondroundofDNAreplication. MicrosatelliteInstabilityENCYCLOPEDIAOFLIFESCIENCES/2001NaturePublishingGroup/www.els.net ' , 1 ) $1 ,#' ,' $ + # $ # ' 1 ' 1! .#?, $ #' )/0/) 1,, ' ,# @A - # )/$' )//0/)) #' & ' )/0/) : 3 " #1 UseofMicrosatelliteInstabilitiesasGeneticMarkers( , , 3 # # , 3 & 1 .#()" % '4 ,B$1, , ' , # , #$ , 3 ) # # # # $ )! 84 8 ' 8 5- &? , FurtherReading/5(3DDE F G ,' G::;:H6/! )DDD G I, ( 7 .6*** & G , G;;;;J )DDJ +G.4" ! " !!#6# 6:E6 G I, ( )( ADDJ ,'+G!"! ' 5 !! # ! ! # EJ5G5 3 )6*** 7, G:;:E (4) (3) FEN1 Figure4Okazakifragmentprocessionmodel.(1)Firstroundofdeoxyribonucleicacid(DNA)replication(synthesisofthelaggingstrand).(2)OkazakifragmentdisplacementbyDNApolymerase(theOkazakifragmentismarkedwithanasterisk).(3)DNAslippageandhairpinformationofthetrinucleotiderepeatlocatedintheOkazakifragment.Thehairpinisresistanttoflapendonuclease(FEN)1processing.(4)UpstreamanddownstreamOkazakifragmentsarejoined.(5)ExpandedrepeataftersecondroundofDNAreplication. MicrosatelliteInstabilityENCYCLOPEDIAOFLIFESCIENCES/2001NaturePublishingGroup/www.els.net