PPT-1st & 2nd Samuel
Author : jane-oiler | Published Date : 2017-04-07
Dig Site 19 Blue Level Questions What did David want to show someone from the house of Saul 91 Kindness The ark of the covenant How to fight a giant A gift from
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "1st & 2nd Samuel" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
1st & 2nd Samuel: Transcript
Dig Site 19 Blue Level Questions What did David want to show someone from the house of Saul 91 Kindness The ark of the covenant How to fight a giant A gift from Jonathan What did David want to show someone from the house of Saul 91. Now . King David was told, “The Lord has blessed the household of . Obed. -Edom and everything he has, because of the ark of God.” So David went to bring up the ark of God from the house of . Obed. Amplification. Primer. Sequence (5’. . 3’). jlpPHI. /VIP. Partial . clone. jlpVIP-F1. CACTCGGACGCGGTGTTCAC. jlpVIP-R1. GGACAGAATGGACTTGGCGT. 5’RACE (1st round). AAP. GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGII. 1 Samuel 2. 27 . Now a man of God came to Eli and said to him, ‘This is what the Lord says: “Did I not clearly reveal myself to your ancestor’s family when they were in Egypt under Pharaoh? . Backgammon 1st and 2nd Moves1. The first move listed is what I use for the first and second move, unless the red second move states otherwise.2. I do not list detail W, G, BG, L, LG, LBG, and equity From Judgeship to Monarchy. 1 SAMUEL: The Book. Named for 1. st. Major Character, who marks the transition from era of Judges to Kings. In Hebrew Bible, “Samuel” = one book, containing 1 & 2 Samuel.. st. & 2. nd. Great Awakenings. 1. st - . 1730-1750. NE primarily. Spontaneous groups. George Whitefield. Jonathan Edwards, . Sinners in the Hands of an Angry God. Significance: 1. st. mass movement in colonies – helped prepare them for independence movement. Woods Runner Literary Elements and Review. 2. Setting. The setting is Colonial America at war, and this takes place in the late 1700s. This is what it looked like in some places during the American Revolution.. Roehampton CC 1. st. XI and 2. nd. XI home fixtures. All fixtures are played on Saturdays and start at 1.00 pm. Date. Roehampton CC. home team. Visitors. 7 May. First XI. Merrow. CC. 14. May. Second. Blue Level Questions. What were the people of Israel to do to return to the Lord with all their hearts? (7:3). Get rid of the foreign gods and . Ashtoreths. Commit themselves to the Lord. Serve the Lord only. Jonathan had . Heroic . F. aith . Then Jonathan said to the young man who bore his armor, “Come, let us go over to the garrison of these uncircumcised; it may be that the Lord will work for . us.. 1 . Hebrews 9:27 And as it is appointed unto men once to die, but after this the judgment:. Saul lost his . sons. .. Saul saw . three. of his sons die. God told him through . Samuel. .. Neither Saul’s son . Billings, WEWIDec 7-0Billings, WEWIBillings, WEWI451Price, FORBPrice, FORB344Kelly, NOJAKeaten Silva (2A-W 1st)MAID, 36-11, 10Silva, MAIDBillings, WEWIDerby, FIFLDerby, FIFLDec 4-2507Mat 9397Mat 9Naiy K StH StM StR St4th StL St1st St5th St3rd StP St6th StF StI St2nd StNew York AveQ StN StO StG StNew Jersey AveQuincy PlBates StInterstate 395North Capitol StG PlMassachusetts AveEckington PlPierce StM Q = 4 + 15X – 7X. 2. 1. st. : . dQ. /. dX. = 15 – 14X. 2. nd. : d. 2. Q/dX. 2 . = – 14. p. = 2(5 – X – 3X. 2. ) – 8X – 15. 1. st. : . d. p. /. dX. = 2(– 1 – 6X) – 8 = – 10 – 12X.
Download Document
Here is the link to download the presentation.
"1st & 2nd Samuel"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents