PDF-Tandem repeats

PDF-Tandem repeats thumbnail
Tandem repeats transposon CAGCAGCAGCAGCAGCAGCAGCAGCAGCAG Much of the sequence between its genes consists of tandem 7nt repeats unique so far amongst bacteria Some

Download Presentation

"Tandem repeats" is the property of its rightful owner. Permission is granted to download and print materials on this website for personal, non-commercial use only, provided you retain all copyright notices. By downloading content from our website, you accept the terms of this agreement.

Presentation Transcript

Transcript not available.

Related Topics