PDF-Tandem repeats

PDF-Tandem repeats thumbnail
Tandem repeats transposon CAGCAGCAGCAGCAGCAGCAGCAGCAGCAG Much of the sequence between its genes consists of tandem 7nt repeats unique so far amongst bacteria Some

Download Presentation

Download Note : "Tandem repeats" is the property of its rightful owner. Permission is granted to download and print materials on this website for personal, non-commercial use only, provided you retain all copyright notices. By downloading content from our website, you accept the terms of this agreement.

Presentation Transcript

Transcript not available.

Related Topics