PDF-Tandem repeats

Author : min-jolicoeur | Published Date : 2015-10-10

Tandem repeats transposon CAGCAGCAGCAGCAGCAGCAGCAGCAGCAG Much of the sequence between its genes consists of tandem 7nt repeats unique so far amongst bacteria Some

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Tandem repeats" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Tandem repeats: Transcript


Download Rules Of Document


"Tandem repeats"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents