EQ Explain how DNA facilitates the creation of life Is DNA important Uhh yeah DNA tells us how things look Without DNA all living things would look and be the same Without DNA there would be no flavors no mating no flowers no zoos no opposable thumbs and no such thing as chocol ID: 491134
Download Presentation The PPT/PDF document "DNA: The most misunderstood chemical in ..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Slide1
DNA: The most misunderstood chemical in the universe
EQ: Explain how DNA facilitates the creation of life!Slide2
Is DNA important?
Uhh, yeah.
DNA tells us how things look. Without DNA, all living things would look and be the same.
Without DNA, there would be no flavors, no mating, no flowers, no zoos, no opposable thumbs, and no such thing as chocolate. Slide3
What the heck even is DNA?
DNA stands for DeoxyriboNucleic Acid.
Because of it’s unique shape, DNA comes in long strands that can be wrapped together.
Therefore, you can have thousands of miles of DNA tightly wrapped in one organism.Slide4
Where is DNA in your body?
DNA is in every cell in your body. The same DNA. Over and over again.
So every cell you have contains your 100 mile long instruction manual.
DNA is in the nucleus, or center, of the human cell. Other types of cells just have the DNA float around randomly.Slide5
What does DNA look like?
How DNA is structured isn’t really as important as how DNA can be arranged.
DNA has four options for its outer shell.
The shell can contain the following proteins:
A
protein
G
protein
C
protein
T
proteinSlide6
Dang DNA, you complicated
DNA can re-arrange it’s shells to make combos.
These combos can make commands. Just like you combine letters to say “Go over there”
DNA can combine it’s letter combos to tell the body to do certain things.
These sequences are called
genesSlide7
That’s why your eyes are blue!
Your eyes are blue because in your DNA, there’s a section whose shell says AAGTC
AATT
CGACGACGATACGGTATGCCTAGC
A green eyed person’s might say:
AAGTC
TTAA
CGACGACGATACGGTATGCCTAGC
Think about this, those type of tiny DNA differences have led to war, famine, hate, and ridicule. Pretty dumb isn’t it. Slide8
So how do all our cells match?
When a cell splits in half, it copies all its DNA
One copy stays with the original cell
The other copy goes with the new created cell
The copies are identical 99% of the time. When an error occurs, we scientists call this a
mutationSlide9
DNA summary
DNA builds different types of life.
DNA allows itself to become an arranging code.
DNA code leads to genes that lead to physical characteristics.
DNA has to be copied to stay in all of our cells, and this copying can have errors in rare cases.