PPT-Indexing FASTA and PEFF files
Author : osullivan | Published Date : 2024-01-13
Luis Mendoza 2 What is PEFF PEFF P SI E xtended F asta F ormat unified format for protein sequence databases to be used by sequence search engines and
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Indexing FASTA and PEFF files" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Indexing FASTA and PEFF files: Transcript
Luis Mendoza 2 What is PEFF PEFF P SI E xtended F asta F ormat unified format for protein sequence databases to be used by sequence search engines and other associated . OT 122. Chapter Two. Intro. Must be a consistent system to work!. Indexing?. Selecting the filing segment under which to store a record and determining the order in which the units should be considered. The essential step in searching. Review a bit. We have seen so far . Crawling . In the abstract and as implemented. Your own code and . Nutch. If you are unsure about anything related to crawling, be sure to speak up now!. makefiles. pipelining for the masses. Make is based on set of rules. # this is a remark. target . : . prerequisites .... recipe_line1. . recipe_line2. .... . <Tab>. Simple . example. Leg.pdf . CSC 575. Intelligent Information Retrieval. Intelligent Information Retrieval. 2. Indexing. Indexing is the process of transforming items (documents) into a searchable data structure. creation of document surrogates to represent each document. Goals:. Store large files. Support multiple search keys. Support efficient insert, delete, and range queries. 2. Files and Indexing. Entry sequenced file. : Order records by time of insertion.. Search with sequential search. Yanbin Yin. Fall 2014. 1. http://. www.ncbi.nlm.nih.gov. /books/NBK52640/. 2. Why you do need to run BLAST in command line terminal?. NCBI’s server does not have a database that you want to search. Dr. med. A. Leander Fontaine. Pharmiceutics. LLC. Oct 2013. Based on FDA’s 2010 indexing SPL FR notice. Indexing:. For a label, providing machine-readable . tags that do . not appear . in actual printed . SQLBits 7. Some things you shouldn’t do. Others you can but will be messy. Simon Sabin. Principal Consultant for SQL Know How. Training and Development for SQL Server. Database design and development, Business Intelligence, Performance tuning and troubleshooting. Gears. A gear is a wheel with teeth along its rim. . It is used to transmit power from one shaft to another.. Production of Gears. Broaching. Hobbing. Shaping. Milling. Lapping. Plastic Injection Molding . February 2014. I attended a class about the new indexing tool at rootstech14 in February 2014. Let me summarize what I learned for you.. This is Scott Flinders, the presenter. Scott is senior product manager in charge of developing the new indexing tool.. . . Texas. . Tech. . University. . Suren. . Byna. . . . Lawrence Berkeley National Laboratory. . . Houjun. . Tang. . GettingStarted 1Install32Supporteddatabases73Paired-endsequencing-97%OTU94Denoising(Illuminaonly)155Single-endsequencing176AnintroductiontothedownstreamanalysiswithRandphyloseq217Computebasicstatistic grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01ForalltxtNextextractallthereadsinthenew28lewithexactly10charactersbeforetheprimerandthenallthereadsinthenew28lewithoutexactly10bpbeforetheprimergrep16Forw SPL/DailyMed Jamboree - October 2013. Lonnie Smith. U.S. Food and Drug Administration. . Overview. Structured Product Labeling (SPL) Overview. Exchange of SPL Data. Indexing SPL Overview. Other SPL-related topics.
Download Document
         Here is the link to download the presentation.
"Indexing FASTA and PEFF files"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
	 
        
Related Documents

 
         
         
         
         
         
         
         
         
         
         
         
         
        