PDF-BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ
grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01ForalltxtNextextractallthereadsinthenew28lewithexactly10charactersbeforetheprimerandthenallthereadsinthenew28lewithoutexactly10bpbeforetheprimergrep16Forw
Download Presentation
"BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCa " is the property of its rightful owner. Permission is granted to download and print materials on this website for personal, non-commercial use only, provided you retain all copyright notices. By downloading content from our website, you accept the terms of this agreement. Download
Presentation Transcript
Transcript not available.