PPT-POLYMORPHISM AND VARIANT ANALYSIS
Saurabh Sinha University of Illinois Outline Predicting when a coding SNP is bad Genomewide association studies What is a SNP Single nucleotide polymorphism I1 AACGAGCTAGCGATCGATCGACTACGACTACGAGGT
Download Presentation
"POLYMORPHISM AND VARIANT ANALYSIS" is the property of its rightful owner. Permission is granted to download and print materials on this website for personal, non-commercial use only, provided you retain all copyright notices. By downloading content from our website, you accept the terms of this agreement.
Presentation Transcript
Transcript not available.