PPT-POLYMORPHISM AND VARIANT ANALYSIS
Author : pasty-toler | Published Date : 2016-06-09
Saurabh Sinha University of Illinois Outline Predicting when a coding SNP is bad Genomewide association studies What is a SNP Single nucleotide polymorphism I1 AACGAGCTAGCGATCGATCGACTACGACTACGAGGT
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "POLYMORPHISM AND VARIANT ANALYSIS" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
POLYMORPHISM AND VARIANT ANALYSIS: Transcript
Saurabh Sinha University of Illinois Outline Predicting when a coding SNP is bad Genomewide association studies What is a SNP Single nucleotide polymorphism I1 AACGAGCTAGCGATCGATCGACTACGACTACGAGGT. Matt Hudson, University of Illinois. Outline. Predicting when a coding SNP or SNV is “damaging”. Genome-wide association studies. What is a SNP ? And a SNV?. Single nucleotide polymorphism. Single nucleotide variant. Deanna M. Church . Staff Scientist, NCBI. @. deannachurch. Short Course in Medical Genetics 2013. FASTQ. BAM. VCF. VCF. FASTQ. BAM. VCF. VCF. Steve Sherry, NCBI. http://. www.bioplanet.com. /. gcat. http://. CT1513. 1. 2. Polymorphism. Can treat an object of a subclass as an object of its superclass. A reference variable of a superclass type can point to an object of its subclass. Person name, . nameRef. Engineering. , . Technical University of . Kosice. , jozef.svajlenka@tuke.sk. Maria. KOZLOVSKA, Marcela SPISAKOVA, . Matus. TKAC. CLAY-BASED HOUSES-SUSTAINABLE METHOD OF CONSTRUCTION . Objectives. The goal of submitted paper is to compare the technological, economic and environmental aspects of sustainable clay-based houses . Assessment. (Boston College & University of Michigan). Gabor Marth, Goncalo Abecasis, PIs. Informatics challenges for genomic analysis. Tool . building. Facilitating . analysis. . Widening. accessibility. Matt . Hudson . Crop Sciences. NCSA. . HPCBio. IGB. University . of Illinois. Outline. How do we predict molecular or genetic functions using variants?. Predicting . when a coding SNP or SNV is “damaging”. Introduction. This slide presentation covers several topics pertaining to Variant classification, reclassification and the . V. ariant . C. lassification . P. rogram (VCP). You may view the presentation in its entirety or click on one of the topics below to go directly to the relevant slides.. Department of Genetics. UNC Chapel Hill. strande@email.unc.edu. Exploring the diagnostic yield of whole . exome. sequencing in a broad range of genetic conditions: . The first 200 cases in the NCGENES study. 2. Static Binding Vs. Dynamic Binding. 3. Binding. means associating a method definition with its invocation. It can be also called . early binding. Polymorphism that is resolved during compiler time is known as static polymorphism. Method overloading is an example of compile time polymorphism.. Several forms of same species or organism is called polymorphism.. This morphological variation occur on regular basis from generation to generation excluding sexual . diamorphism. and metamorphosis (a changes from larva to pupa).. Sequencing. . Paolo Aretini . Senior . Researcher. Fondazione Pisana per la Scienza. School on . Scientific. Data Analysis,. 25-28 . November. 2019. Scuola Normale Superiore . Outline. Introduction. Vojtěch Bystrý. 29. . October. 2018. Goals of the presentation. O. verview. of NGS bioinformatics . NGS . bioinformatics < Sequence analysis < Bioinformatics. W. hat to think about when you . Vojtěch Bystrý. CEITEC Bioinformatics Core Facility. CEITEC research areas. FI MUNI Bioinformatics Seminar. 2. Bioinformatics CF mission . Primary NGS analysis. S. econdary standard NGS analysis. Custom (project specific) analysis. PROBAND. REQUEST FORM. Please provide the following information. We cannot perform your test without ALL of this information. PLEASE PRINT ALL ANSWERS. * Required information . **Please refer to the special requirements for prenatal samples on the Instructions for Sample Submission page..
Download Document
Here is the link to download the presentation.
"POLYMORPHISM AND VARIANT ANALYSIS"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents