PPT-POLYMORPHISM AND VARIANT ANALYSIS

Author : pasty-toler | Published Date : 2016-06-09

Saurabh Sinha University of Illinois Outline Predicting when a coding SNP is bad Genomewide association studies What is a SNP Single nucleotide polymorphism I1 AACGAGCTAGCGATCGATCGACTACGACTACGAGGT

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "POLYMORPHISM AND VARIANT ANALYSIS" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

POLYMORPHISM AND VARIANT ANALYSIS: Transcript


Saurabh Sinha University of Illinois Outline Predicting when a coding SNP is bad Genomewide association studies What is a SNP Single nucleotide polymorphism I1 AACGAGCTAGCGATCGATCGACTACGACTACGAGGT. Copy Number Variations. and SNP Array. Xiaole Shirley Liu. and . Jun Liu. 2. Outline. Definition and motivation. SNP distribution and characteristics. Allele frequency, LD, population stratification. Chapter Eight. Modern Programming Languages, 2nd ed.. 1. Introduction. Compare these function types. The ML function is more flexible, since it can be applied to any pair of the same (equality-testable) type. Matt Hudson, University of Illinois. Outline. Predicting when a coding SNP or SNV is “damaging”. Genome-wide association studies. What is a SNP ? And a SNV?. Single nucleotide polymorphism. Single nucleotide variant. CT1513. 1. 2. Polymorphism. Can treat an object of a subclass as an object of its superclass. A reference variable of a superclass type can point to an object of its subclass. Person name, . nameRef. Assessment. (Boston College & University of Michigan). Gabor Marth, Goncalo Abecasis, PIs. Informatics challenges for genomic analysis. Tool . building. Facilitating . analysis. . Widening. accessibility. Matt . Hudson . Crop Sciences. NCSA. . HPCBio. IGB. University . of Illinois. Outline. How do we predict molecular or genetic functions using variants?. Predicting . when a coding SNP or SNV is “damaging”. ZOOM ON. . GATK. Cedric Notredame. Adapted from . Yannick. . Boursin. Genetic. . variations. Variations . at the (A) . nucleotide level. . and. (B) . structural level. (C) Single nucleotide . polymorphism . Introduction. This slide presentation covers several topics pertaining to Variant classification, reclassification and the . V. ariant . C. lassification . P. rogram (VCP). You may view the presentation in its entirety or click on one of the topics below to go directly to the relevant slides.. Steven Harrison (. sharrison@bwh.harvard.edu. ). March 22, 2018. SVI. Updates. Reputable source (PP5/BP6) paper. Bayes paper. PVS1 (. LOF. ) recommendation. PS2/PM6 (De novo) recommendation. Reputable Source Letter to the Editor . Moloud Payab. Obesity and Eating Habits Research Center, Endocrinology and Metabolism Molecular -Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran, Iran. 1. Table of content. ACMG/AMP Variant . Interpretation . guidelines . (. Richards et al 2015). Population. Data. In . silico. Data. Segregation . Data. Database. Prevalence in . affecteds. statistically increased over controls. Exomes. /WGS. Ramesh Nair. May 31, 2013. Outline. Types of genetic variation. Framework for variant discovery. Variant calling methods and variant callers. Filtering of variants. Structural variants. 2. Static Binding Vs. Dynamic Binding. 3. Binding. means associating a method definition with its invocation. It can be also called . early binding. Polymorphism that is resolved during compiler time is known as static polymorphism. Method overloading is an example of compile time polymorphism.. RFLP. ). Fluorescence . in situ . Hybridization . (. FISH. ). Start C. odon Targeted . (. SCoT. ) P. olymorphisms. E. xpressed . S. equence . T. ag . (. EST. ). Random Amplified Polymorphic DNA (. RAPD.

Download Rules Of Document


"POLYMORPHISM AND VARIANT ANALYSIS"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents