/
01010110001001010000101010101001101110011000110010100010010 01010110001001010000101010101001101110011000110010100010010

01010110001001010000101010101001101110011000110010100010010 - PowerPoint Presentation

phoebe-click
phoebe-click . @phoebe-click
Follow
363 views
Uploaded On 2016-05-15

01010110001001010000101010101001101110011000110010100010010 - PPT Presentation

Introduction Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Cost Killer apps Roadblocks How soon will we all be sequenced Time 2013 2018 Cost Applications ID: 320297

human selection positive ancestry selection human ancestry positive humans allele population amp genome disease africa detect project linkage snps

Share:

Link:

Embed:

Download Presentation from below link

Download Presentation The PPT/PDF document "0101011000100101000010101010100110111001..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript

Related Contents


Next Show more