Search Results for 'Sbatch-Xsede'

Sbatch-Xsede published presentations and documents on DocSlides.

Using the BYU Supercomputers
Using the BYU Supercomputers
by danika-pritchard
Resources . Basic Usage. After your account is ac...
HPC at HCC
HPC at HCC
by yoshiko-marsland
Jun Wang. . hcc.unl.edu. Outline of . Workshop3...
Steve Leak, and Zhengji
Steve Leak, and Zhengji
by briana-ranney
. Zhao. NESAP . Hack-a-thon. November 29, 2016, ...
HPC at HCC Jun Wang    hcc.unl.edu
HPC at HCC Jun Wang hcc.unl.edu
by mitsue-stanley
Outline of . Workshop3. Overview . of Current HPC...
Welcome to Kamiak 10/2/2017 Training Session
Welcome to Kamiak 10/2/2017 Training Session
by trish-goza
Aurora Clark, CIRC Director. Peter Mills, Computa...
Using Longleaf ITS Research Computing Karl Eklund   Sandeep
Using Longleaf ITS Research Computing Karl Eklund Sandeep
by calandra-battersby
Using Longleaf ITS Research Computing Karl Eklund...
Introduction - The basics of compiling and running on KNL
Introduction - The basics of compiling and running on KNL
by kaptainpositive
Zhengji. Zhao. User Engagement Group . Cori KNL U...
Running VASP on Cori KNL
Running VASP on Cori KNL
by reportssuper
Zhengji. Zhao. User Engagement Group . Hands-on V...
BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ
BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ
by payton
grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01Fora...
UPR - Department of Biology
UPR - Department of Biology
by cadie
College of Natural Resource. Río Piedras Campus. ...
Regulatory Genomics Lab Regulatory Genomics  | Saurabh Sinha | 2021
Regulatory Genomics Lab Regulatory Genomics | Saurabh Sinha | 2021
by Dreamsicle
1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...
Supercell storms: In-class demo and Experiment 3
Supercell storms: In-class demo and Experiment 3
by bitsy
ATM 419/563. Spring 2017. Fovell. 1. Goals. Start ...
Intermediate MATLAB  ITS Research Computing
Intermediate MATLAB ITS Research Computing
by adah
Mark Reed . Lani Clough. Objectives. Intermediate....
Regulatory Genomics Lab Regulatory Genomics  | Saurabh Sinha | 2023
Regulatory Genomics Lab Regulatory Genomics  | Saurabh Sinha | 2023
by adah
1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...
Access/log in to longleaf
Access/log in to longleaf
by joanne
: . ssh. or OOD. Check your quota for home, users...
Using HPC for Ansys CFX and Fluent
Using HPC for Ansys CFX and Fluent
by lindy-dunigan
John Zaitseff, . March 2016. High Performance Com...
Working on UC Davis Bioinformatics Core Administrated Compu
Working on UC Davis Bioinformatics Core Administrated Compu
by yoshiko-marsland
Outline. Introduction/Questions. Explain . user s...
Bacterial Genome Assembly
Bacterial Genome Assembly
by nicole
Chris Fields. Genome Assembly | Saba Ghaffari | 20...
Introduction to RNA-Seq & Transcriptome Analysis
Introduction to RNA-Seq & Transcriptome Analysis
by cady
Jessica Holmes. 1. PowerPoint by Shayan Tabe Bordb...
Regulatory Genomics Lab Saurabh Sinha
Regulatory Genomics Lab Saurabh Sinha
by CutiePie
Regulatory. . Genomics. | Saurabh . Sinha. | 2...
NESIS estimates for the SOC case
NESIS estimates for the SOC case
by leah
ATM 419. Spring 2016. Fovell. 1. RIP (Read-Interpo...
Welcome to the National Physical Laboratory
Welcome to the National Physical Laboratory
by isabella
Simulation Based Study of a Diffusion MRI Process ...