PPT-35S P.
Author : sherrill-nordquist | Published Date : 2018-01-22
tAPX or GUS tAPX or GUS intron NOS T G 1090 P XVE T3A T3A Lex A P ccdB G 1090 P XVE T3A T3A Lex A P tAPX or GUS tAPX or GUS intron Xba I pGWB80tAPX or GUS
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "35S P." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
35S P.: Transcript
tAPX or GUS tAPX or GUS intron NOS T G 1090 P XVE T3A T3A Lex A P ccdB G 1090 P XVE T3A T3A Lex A P tAPX or GUS tAPX or GUS intron Xba I pGWB80tAPX or GUS. 2564Biochemistry:HuibregtseetalPconfirmedbystandardmethods.TheratplOOcDNAandtheC-AmutantofratplOOwereclonedsimilarlyfromaplasmidprovidedbyDietmarRichter(13).ThioesterandUbiquitinationAssays.[35S]Methi Moderator. Amy Dallaway, Marine Claims Adjuster, Antares. Panellists. Jonathan Evans, Partner, Kennedys Law LLP. Bradleigh-Aaron McArthur, Senior Marine Claims Broker, RKH Specialty. Heather Robinson, Average . --/01-23/4526720385925-25303/0-0/02-x0000-6-/210A0B050-/012342C0750M--63320//744N5OPFLQMRS5TUPVIEV-3320//--/01-23/W6-45XM320S/-4/512342Y-08Z07250033020M-6252XN-2320X8B05S--N-23/Z2/120031X60/KVN2003-6- 1030CellBiologyBleilandWassarman25095u30ONL10ONCL108sx000010-02X10G3C24G81012TIMEhrs25Dn152v10015E153020O10IQ15102050n-o15FIG1Incorporationof35Smethionineand3HfucoseintooocyteandzonapellucidaproteinsD 102030405060708090AATTCTGCCGCCACCTCGCGAATAATGTGGATGCTTTCCGCCTCCAGTTGCCGCAGGTGAGTAAGTCGTATTTGATCCATAACCGTTCCT100110120130140150160170180TTGCAATACCGCTATTTTCTTGCCATCAGATGTTTCGACTATAGGGAGCGTAAGAGAACGAATGA KAVITA BASUMATARY. ASSISTANT PROFESSOR. DEPARTMENT OF BOTANY . GOALPARA COLLEGE. Structure of Virus:. The . CaMV. genome consists of circular, double-stranded DNA approximately 8000 bp in length.. The genome contains three discontinuities typical of .
Download Document
Here is the link to download the presentation.
"35S P."The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents