Analyzing Sequences Sequences: An Evolutionary
1 / 1

Analyzing Sequences Sequences: An Evolutionary

Author : aaron | Published Date : 2025-05-12

Description: Analyzing Sequences Sequences An Evolutionary Perspective Evolution occurs through a set of modifications to the DNA These modifications include point mutations insertions deletions and rearrangements Seemingly diverse species say mice

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Analyzing Sequences Sequences: An Evolutionary" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Transcript:Analyzing Sequences Sequences: An Evolutionary:
Analyzing Sequences Sequences: An Evolutionary Perspective Evolution occurs through a set of modifications to the DNA These modifications include point mutations, insertions, deletions, and rearrangements Seemingly diverse species (say mice and humans) share significant similarity (80-90%) in their genes The locations of genes may themselves be scrambled Chromosomal Rearrangements Mouse genome mappings to human genome. Mouse Genome Mouse genome 2.5 Gb vs human 2.9 Gb Can identify regions of synteny between mouse and human for 90% of genome. Both genomes have ~30,000 genes 99% of mouse genes have a human homolog (and vice versa) Some genes appear to have evolved more quickly than random chance (immunity and reproduction). Gene Duplication Gene duplication has important evolutionary implications Duplicated genes are not subject to evolutionary pressures Therefore they can accumulate mutations faster (and consequently lead to specialization) Inversions Para and pericentric inversions Transposition A group of conserved genes appears in a transposed fashion at a different location Comparing Sequences Define distance between two sequences as the number of mutations that would result in the second string, starting from the first ACGGCGTGCTTTAGAACATAG AAGGCGTGCTTTAGAACATAG AAGGCGTGCGTTAGAACATAG ACGGCGTGCGTAAGGACAATAG Evolution and Edit Distances Plotting Genome Rearrangements Diagonals imply direct alignment Reverse diagonals imply inverse alignment How do we get sequences? Sanger sequencing: Gel electrophoresis is process of separating a mixture of molecules in a gel media by application of an electric field. In general, DNA molecules with similar lengths migrate same distance. First cut DNA at each base: A, C, G, T. Then run gel and read off sequence Sanger Sequencing Pyrosequencing The single-stranded PCR products to be sequenced are added to microtiter wells together with sequencing primer. Nucleotides A, C, G and T are added sequentially to each well together with the enzyme and substrate mixture. Incorporation of a nucleotide in the growing DNA-strand results in the production of one molecule of pyrophosphate (PPi). PPi is quantitatively converted into visible light by an enzyme mixture containing luciferase. The light signal emitted is detected by a CCD camera and seen as a peak in the pyrogram.

Download Document

Here is the link to download the presentation.
"Analyzing Sequences Sequences: An Evolutionary"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Presentations

A new movement to communicate evolutionary science to a dou Evolutionary algorithms Evolutionary Art Chapter 5: Experimental Evolutionary CS 478 - Evolutionary Algorithms Module 6 Genetics, Evolutionary Psychology, and Behavior Chapter 2 – Logic	 Analyzing Arguments Are your feelings just another evolutionary adaptation? Behavior Genetics and Evolutionary Psychology Sequences and Series Number sequences, terms, the general term, terminology. Analyzing Companies and Industries Applications of Evolutionary Algorithms Evolutionary Computing Chapter 2 SUBDISCIPLINES OF EVOLUTIONARY BIOLOGY Behavioral EvolutionEvolution o