PPT-When You Have Too Much Data, “Good Enough” Is Good Enough

Author : yoshiko-marsland | Published Date : 2018-03-20

Pat Helland Unemployed Software Architect 1 Outline Introduction Watering Down the ACID Schema We Dont Need No Stinking Schema Contortion and Distortion Dreaming

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "When You Have Too Much Data, “Good Eno..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

When You Have Too Much Data, “Good Enough” Is Good Enough: Transcript

Pat Helland Unemployed Software Architect 1 Outline Introduction Watering Down the ACID Schema We Dont Need No Stinking Schema Contortion and Distortion Dreaming of Streaming Swimming While Syncing. Are Christians Judged? made ve more. In other words, our faithfulness in this life will somehow affect the eternal life to come.We should be really careful here lest we think that eternity will be le Ensuring Enduring Access: A Forum on Digital Preservation, July 21, 2009. The Good, The Bad & The Missing. The Good, The Bad & The Missing. Scan-converted Broadcast Image. Original SSTV Image. What is a claim?. Definition: . A claim states your position on the issue you have chosen to write about. .. What makes a good claim?. A good claim is not obvious. Why bother proving a point nobody could disagree with?. Created male and female in God’s image (Gen 1:26-27). 26 . Then God said, “Let us make man in our image, after our likeness. And let them have dominion over the fish of the sea and over the birds of the heavens and over the livestock and over all the earth and over every creeping thing that creeps on the earth.”. Rhiannon Bettivia, Doctoral Student. Preserving Virtual Worlds II: IMLS Grant Partnership between University of Illinois, Stanford, Rochester Institute of Technology, and University of Maryland. Primary question: How do we determine what is significant about games and thus what about them needs to be preserved?. Research Methods for the IS . Manager. 2. Introductions – Me!. In HK since 1991; Travels in . 87 . countries.. Teaching non-technical IS courses to MSc and PhD . students. IS6000, IS6600, FB5003, IS8004, etc.. 0010010010. 1001011100. 01010000110000101001. 1001011011. 0010100100. 00100100101. 10001010011. 10001010011010. ataacgtagcacatagtagtccagtagctgatcgtagaactgcatgatccaagctgctgatacgatgaacacctgagatgctgatgctgatagctagtcg. Capture-Recapture. Kneser. -Ney. Additive Smoothing. https://. en.wikipedia.org/wiki/Additive_smoothing. . Laplace Smoothing. Jeffreys. Dirichlet. Prior. What’s wrong with adding one?. 10/27/2017. Fork . Watershed. Draft Watershed Hydrology and Water Quality Calibration. and. Draft Water Quality Model. Technical Advisory Committee . Meeting #1. Louisville, KY. July 26. th. , 2012. Presenters. Tim Wool National TMDL Expert Water Quality Modeler, TOM. 20.04.2016. Kristin Bergtora Sandvik . (1) The (academic) story so far. Academic engagements: . coming late & quickly outdated? . Science and technology studies (STS). Framing of tech as solution to humanitarian problems? Game changer logic. Navigating the University: Research and Resources Management Retreat. August 19, 2016. Michael Jamieson . DRSc. Associate Director, International Center for Regulatory Sciences. Assistant Professor, Clinical Pharmacy. What are the major advantages and disadvantages of surveys? . Determine content and purpose of question. Choose the response format. Figure out how to word it. Figure out where to put it. Pilot test!. Good points – Good information on a variety of subjects Wide range of speakers Well balanced information Good agenda Good venue Improvements – More opportunity for networking & discussion Shorter sessions (for engagement purposes) BEN IGN BENE FICIAL BON US BON VOYAGE The Root Ben, bene Ben, bene , bon= good well  Benign - showing kindness, favorable, not harmful She is a friendly, benign teacher; she does not get angr

Download Document

Here is the link to download the presentation.
"When You Have Too Much Data, “Good Enough” Is Good Enough"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.