Highlighting Excellent Research at ACEGID - PowerPoint Presentation

Slide1

Highlighting Excellent Research at ACEGID

Judith U. Oguzie, DVMPhD Research Fellow, World Bank-African Center of Excellence for Genomics of Infectious Diseases (ACEGID)Redeemer’s University, Ede, Nigeria

How?

By establishing a continental consortium of key national laboratories, academic and public health institutions to advance outbreak surveillance and research in Africa

What?

Generate and analyze the genomic diversity of Pathogens in real-time to map the spread of the disease and characterize its pathogenicity, virulence and to inform public health preventive and control measures. real-time to map the spread of the disease and characterize its pathogenicity, virulence and to inform public health preventive and control measures.​

jdhd

Why?

We want to understand and control transmission of infectious

diseases

in Africa to save lives and protect an already fragile health system

Rapid sequencing of Ebola Virus-Summer 2014: Data made public immediately.

New deep Sequencing Methods for Lassa and Ebola viruses developed and published immediately for the benefit of the community (

Matranga CB et al. Genome Biol. 15 (2014)

June 2014: 99 genomes publicly availableAnother 150 genomes released between March 2014 and August 2015

First large-scale genome sequence-based analysis of the circulating Ebola viral population

10 days from sample to Genbank

The data were generated super quickly!

We Developed the First EBOLA RDT

1st

Generation Ebola Virus RDT Approved for EU by WHO and US FDA

Next Generation Sequencing Capacity

Real-time PCR

Real-time Diagnosis: Key to West Africa Successful Containment of the 2014 Ebola Outbreak.

June 2014: 99 genomes publicly available

Another 150 genomes released between March 2014 and August 2015

First large-scale genome sequence-based analysis of the circulating Ebola viral population

Next Generation Sequencing of Lassa Virus Genomes

• ~

4

00 patient samples• 22 Rodents

• Unbiased sequencing - no specific amplification

• Average 1,000X coverage of Lassa genome

Real-time Genome Sequencing of Outbreak samples

Whole Genome sequencing of 90% of 2018 outbreak samples.

Lassa virus extensive genetic diversityTransmission pattern of Lassa virus clustered by Geography. Rodents to human transmission

Metagenomic

analysis of blood samples obtained from Lassa Fever patients in Nigeria

Oguzie et al 2019

Control

Test Line

Lassa virus validation of Rapid Diagnostic Test Kit

Sensitivity = 85%Specificity = 90% Also validated for testing of urine and saliva samples.

2018 YFV sequences formed a tightly clustered clade.

The 2018 clade was more closely related to sequences from other West African countries than to earlier (1946–1991) Nigerian sequences

Next Generation Sequencing of COVID-19 Samples:

SARS-CoV-2 Genome analysis from Nigeria

OVER 70,000 COVID-19 SUSPECTED SAMPLES

TESTING

METAGENOMIC SEQUENCING

Boost testing capacity from 300 to over 5000 per day at ACEGID

First African SARS-CoV-2 genome sequenced was in ACEGID,

RUN,Ede

, Nigeria in 48 hours.

Announced in March 06, 2020

The sample of the index case was sent to the ACEGID lab for

sequencing on 1st March, 2020.

Using one of the two Illumina MiSeqs in the sequencing platform

of ACEGID, we sequenced the sample and obtained a full genome of SARS-CoV-2 within 48 hours.

We obtained all HCoV

whole genome sequences obtained from

human hosts with geographical annotations from GISAID

and aligned with the index genome sequence from Nigeria.

The genome clusters with a European clade, consistent with the

known travel history of this case (Figure 1).

Figure 1

: Maximum likelihood tree of SARS-CoV-2 including Nigeria’s index case

SARS-CoV-2 Genomes from Nigeria

We have

screened over twenty thousand (20,000) samples for SARS-COV-2 by rt-qPCR.

Currently, we have sequenced over 1300 SARS-CoV-2 samples across the country and have assembled 623 genomes so far from twenty-six (26) states of the country.

SARS-CoV-2 PANGO Lineages in Nigeria

At the moment, there are about 37 different lineages of SARS-CoV-2 circulating in Nigeria and they are changing at a very fast speed. Currently, B.1.525 accounts for the largest after taking over the B.1.1.7 (second largest) PANGO lineage in Nigeria.

.

Detection of B.1.1.7 lineages (UK Variant of Concern) in Nigeria

Since the first B.1.1.7 genome detected in Edo State, Nigeria, 14th December, 2020. 339 genomes have been assembled since then and 97 (28.6%) of them are B.1.1.7

As at 24th of May 2021, we have detected a total of 106 cases of the B.1.1.7 lineage across Nigeria

These samples were collected between 14th December, 2020 and 22nd of February, 2021.

Discovery of the Nigeria Lineage- B.1.525

On the 11th of February, some recent SARS-CoV-2 genomes from England (28), Nigeria (10), USA (7), France (5), Canada (4), Ghana (4), Japan (4), Jordan (2), Belgium (1), Italy (1) and Spain (1) were seen to have distinct mutations. These new cluster of viruses have characteristic Spike protein mutations: E484K, Q677H, F888L, 69 - 70 deletion, 144 deletion and 9 nucleotide mutations in the Non-structural protein 6 (nsp6) as seen in

B.1.1.7, B.1.351 and P.1. Origin of this new cluster so far is located in Nigeria.

B.1.525 lineage (Variant of interest) in Nigeria

Currently observed in 9 states across the country with a total of 147 genomes

1st B.1.525 was from an Edo State sample dated 20th December, 2020. Since the detection of B.1.525, 339 genomes have been assembled and (43%) were B.1.525

Discovery of a New variant B.1.1.318 (Variant under investigation) in Nigeria

The B.1.1.318 lineage has been discovered in samples from Lagos, Akwa-Ibom, Oyo and Ebonyi states through whole genome sequencing of COVID-19 positive samples, as far back as January 2021.

This new variant has spread within and outside AfricaThis variant has Spike mutations D614G, D796H, E484K, P681H, T95I and Y144 deletion

So far, 8 genomes have been sequenced and this lineage has the potential to spread rapidly like the B.1.1.7 and B.1.525 due to the E484K mutation in the Receptor binding domain and the P681H in the furin cleavage site of the virus.

Because of the E484K and other mutations in the RBD of the spike protein, there is a risk for immune escape for this variant just like the B.1.525 variant.

Second wave of SARS-CoV-2 in Nigeria

Epicurve of SARS-CoV-2 confirmed cases in Nigeria. States that contributed to the resurgence are highlighted in red (Lagos State, FCT Abuja and Kaduna State. Source: NCDC, 2021

Metagenomics of COVID samples

Assembled a partial genome of Morbillivirus measles virus (85% of viruses from Kraken2 hit) was assembled from a PCR SARS-CoV-2 positive sample

Summary: SARS-CoV-2 Sequencing in Nigeria

Multiple introductions into Nigeria from different parts of the world.

Detection of B.1.1.7 variant of concern in Nigeria

Evidence of community transmission in different states of Nigeria.

The two variants of concern (B.1.1.7 and B.1.525) now account for 80% of the genomes in the country since their detection in December 2020.

D614G mutation taking over in the country.

Emergence of B.1.525 variant under investigation in Nigeria which is spreading rapidly like the B.1.1.7

SARS-CoV-2 Genome Analysis from Somalia

So far we have generated 18 genomes from Somalia samples.Including A, B.1, B.31, and B.1.422 lineagesWith the B.1 being the most dominant.

SARS-CoV-2 LINEAGES IN CAMEROON

Thirty-nine (39) full SARS-CoV-2 genomes were assembled from sequenced Cameroon COVID-19 samples sent to the ACEGID lab using

Lineage in Cameroon: A.23.1, A.27 and W.1

All of these lineages have mutations with potential for increase transmission and evade the immune system.So far, only 2 genomes have been assembled which belongs to the A.23.1

lineage.Only 2 genomes have been assembled so far that belong to W.1

GGTGGAAAGTTGTTGGGCGGTATAGAGTTTGATGTGACTCACAAAGGATGGCCTATTGCATAGACTGAAAACTAATGACTTTGCCCCTGCATGGTCAATGACAGGAACCTATTTCCCATTTATTTCAAATCCGAATTCCACATTGAATCACCGCTGTGGGCACTGAGAGTCATCCTTGCTGCAGGGATACAGGACCAGTTAATTGACCAGTCTTTGATTGAACCCTTAGCAGGAGCCCTTGGTTGATCTCTGATTGGCTGCTAACAACCAACACTAACCATTCAACATACGAACACAACGTGTCAAGGAGCAATTGAGCCTAAAAATGCTGTCGTTGATTCGATCCAATATTCTCAAGTTTATTAACGAATTGGAGCTCTACATGTTGTGAACTATAATGGATTATTGAGCAGTATTGAAATTGGGACTCAAAATCATACAATCATCATAACTCGAACTAACATGGGTTTTCTGGTGGAGCTCCAAGAACCCGACAAATCGGCAATGAACCGCAAGAAGCCTGGGCCGGCGAAATTTTCCCTCCTTCATGAGTCCACACTGAAAGCATTTACACAAGGGTCCTCGACACGAATGCAAAGTTTAATTCTTGAATTCAATAGCTCTCTTGCTATCTAACTAAGATGGAGTACTTCATATTGGGCTAACTCATATATGCTGACTCAATAGTTAACTTGACATCTCTGCCTTCATAATCAGATATATAAGCATAATAAATAAATACTCATATTTCTTGATAATTTGTTTAACCACAGAGAAATCCTCACTGTAAGCCAGCTTCCAAGTTGACACCCTTACAAAAACCAGGACTCAGAATTCCTCAAATAAGAGATTCCAAGACAACATCATAGAATTGCTTTATTATATATTAATAAGCATTTTATCACTAGAAATCCAATATACGAAATGGTTAATTGTAACTAAACTCGCAGGTCATGTGTGTTAGGTTTCACAAATTATATATATTACTAACTCCATACTCATAACTAACATTAGATAAGTAGGTTAAGAAAAAAGCTTGAGGAAGATTAAGAAAAAACTGCTTATTGGGTCTTTCCGTGTTTTAGATGAAGCAGTTGACATTCTTCCTCTTGATGTTAAATGGCTACACAACATACCCAATACCCAGACGCCAGGTTATCATCACCAATTTATTGGACCAATGTGACCTTGTCACTAGAGCTTGCG

EMPOWERING LOCAL CLINICIANS

ENHANCING LOCAL VIRAL DIAGNOSTICS

Mobile platform for data collection

Designed in close collaboration with clinicians and staff

Streamline existing workflows

Audiovisual aids for patient enrollment

CRISPR-based SHERLOCK diagnostics

Low cost, deployable lateral flow assay

Highly sensitive and specific

Designed, tested and deployed RUO Lassa assay in 2 weeks

Our

A

pproach

:

G

enomics

-informed clinical tools

SHINE (Streamlined Highlighting of Infections to Navigate Epidemics)

Ambient-temperature, no equipment required, higher throughput

Ambient-temperature, no equipment required

Validated in Nigeria

Tested 500 Nigerian RNA samples extracted from clinical samples (saliva, nasal swabs)

Test performed well on samples with high viral load but needs improvement for samples with low viral load.

SHINE Assay Validation

Fully field deployable

Urine

Saliva

Control line

Test line

Dengue Patient

Healthy

Rapid assay development

Day 1:

Design crRNAs & RPA primers

Days 2-5:

crRNAs, primer, target synthesis

Day 6:

SNP testing

All human-associated viruses with ≥10

genomes

Design

and select

primers and crRNAs

CATCH-dx

Comprehensively

test

cross-reactivity

(8 chips; 28,561 tests)

Extensive test of cross-reactivity (169

×

169), using synthetic targets at 10

4

cp/ul

CARMEN - CRISPR-Cas13 in massive multiplex

Data Availability

Open protocols (data generation, assembly and analysis).Open data but FAIR research (involve, acknowledge and capacitate).Open updates to public health officials and general public (pandemic responsiveness before academic exercise).

Dr. Christian Happi

African Center of Excellence for Genomics of Infectious DiseaseRedeemer’s UniversityHarvard T.H. Chan School of Public Health

SENTINEL – Pandemic Preemption and Response

Dr. Pardis Sabeti

Broad Institute of MIT and Harvard

Harvard T.H. Chan School of Public Health

Howard Hughes Medical Institute

Conclusion

Genomic data generated are the bases for diagnostics development and improvement.Our research output has been instrumental in vaccine development for Lassa virus and SARS-COV-2.Several Public health interventions such as mass YFV vaccination in affected communities and lock down recommendations during SARS-COV2.

Genomic surveillance is an ongoing effort and we keep making our data publicly available to the scientific community.

Acknowledgements

Outstanding Partners

Redeemer’s University

Irrua

Specialist Teaching Hospital

NCDC

Viral Hemorrhagic Fever Consortium

Broad Institute of Harvard and MIT

Harvard University

Tulane University

UCAD, Senegal

KGH, Sierra Leone

NPHI, Liberia

Zalgen

University of Cambridge

FETHA

FMC-

Owo

Generous Funders

outbreaks genomic response team