PPT-Using Drosophila to
Author : alexa-scheidler | Published Date : 2016-05-22
Study the PINK1Parkin Mitochondrial Quality C ontrol P athway Leo Pallanck University of Washington Mitofusins Drp1 The PINK1Parkin Pathway Mitofusins Parkin
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Using Drosophila to" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Using Drosophila to: Transcript
Study the PINK1Parkin Mitochondrial Quality C ontrol P athway Leo Pallanck University of Washington Mitofusins Drp1 The PINK1Parkin Pathway Mitofusins Parkin PINK1 Lysosome Mitofusins. 624 . - Developmental Genetics. Lecture . #4 – . Gastrulation. . Movements. . GASTRULATION is a complex series of cell movements that:. --rearranges cells, giving them new neighbors. --results in the formation of 3 GERM LAYERS that will form the subsequent embryo: ectoderm, endoderm and mesoderm. Tara . Pulvermacher. http://siakhenn.tripod.com/snoring.html. What Restless Leg Syndrome looks like. http://www.youtube.com/watch?v=k2eGoHk9AAc. . http://www.ninds.nih.gov/disorders/restless_legs/detail_restless_legs.htm. ABSTRACT Function in Drosophila melanogaster Duke University Date:_______________________ Approved: ___________________________ Daniel P. Kiehart, Supervisor ___________________________ Daniel J. Lew Pest of thin-skinned fruit . Found throughout the eastern states to North Dakota. Can attack sound fruit before they fully ripen. What makes this fruit fly different is the females ovipositor (egg layer), it has teeth to penetrate the skin of fruit. John . Noto. BIO441 Lecture. 24 April 2017. Development. . Development refers to interaction of the genome with the cytoplasm and external environment to produce a programmed sequence of typically irreversible events.. Orb2 dependent . long-term memory maintenance in Drosophila . Natalie . Galles. S. N. Bose Research Exchange. Summer 2016. Lab 11 . nccs. – . pune. Internship at NCCS, Pune. Spent my 8 weeks working in Lab 11 under direction of Dr. . protein content has also been found to aect lifespan 23], and this would be increased following a heavy probiotic diet. Furthermore, increased expression of antioxidant enzymes (superoxide dismutase Wilson Leung 01/2014. Agenda. Overview of the modENCODE species. Problems with the version 1 genome assembly. Improvements in the version 2 genome assembly. Pipeline used to create the sequence improvement projects. ADRC 2014, San Diego. In this talk….. Why human disease models?. The data so far. Searching human disease model data. What’s next?. . 1993. 1998. 2003. 2008. 2013. Drosophila papers containing “disease” in the abstract or title. Mutant organisms. What is a mutant organism?. An organism with a permanent change to its genome. What are mutants used for in research?. Expression of a fluorescent protein in a single pair of neurons . Drosophila . melanogaster. Drosophila Melanogaster, a popular genetic model organism. ~ 50% of fly genes have vertebrate homologs. Small and easy to grow in lab. Short generation time . Produce high amounts of offspring. Drosophila Medium Ingredients Gms / Litre Brewers yeast, dried 13.300 Corn Meal 133.000 V-8 vegetable juice 180.000 Methyl parahydroxybenzoate 0.093 Agar 13.300 Final pH ( at 25°C) Suspend 3 grams in . Phylogenetic relationships and estimated divergence times of major lineages in the genus Drosophila. Taxa in bold are pr 2606 frame (ORF) was cloned into the I site of pAc5.1/c-MYC-HISAusing the following PCR primers: AcCYLD-F: 5-CCCGAATTCC A -AAATGATCTTAAACAACAA AAG TAAAAC-3CCCCTCGAGATGGTACATCATTA TATCTGTGC-3MYC-HIS A
Download Document
         Here is the link to download the presentation.
"Using Drosophila to"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
	 
        
Related Documents

 
         
         
         
         
         
         
         
         
         
         
         
         
        