PPT-Overview of the Drosophila modENCODE hybrid assemblies
Author : hazel | Published Date : 2022-06-11
Wilson Leung 012014 Agenda Overview of the modENCODE species Problems with the version 1 genome assembly Improvements in the version 2 genome assembly Pipeline used
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Overview of the Drosophila modENCODE hy..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Overview of the Drosophila modENCODE hybrid assemblies: Transcript
Wilson Leung 012014 Agenda Overview of the modENCODE species Problems with the version 1 genome assembly Improvements in the version 2 genome assembly Pipeline used to create the sequence improvement projects. The Task. You will be taking part in a catwalk assembly where you will have to describe what clothes the person is wearing and describe the colours.. You would have never seen the outfit before, so quick thinking on your heels is the only option.. Without giving it all away!. Jim Krivoshein. Technical Analyst. Computer Aided Technology, Inc.. www.cati.com/sww2012. 1. Sharing Assemblies. Without giving it all away!. Have you ever wanted someone else’s product to add into your own assembly model?. definition. Legislative bodies. Their formal approval usually required for major public policies. Generally elected by popular vote. Also called legislatures, parliaments, senates, chambers, houses, or diets. Pest of thin-skinned fruit . Found throughout the eastern states to North Dakota. Can attack sound fruit before they fully ripen. What makes this fruit fly different is the females ovipositor (egg layer), it has teeth to penetrate the skin of fruit. La gamme de thé MORPHEE vise toute générations recherchant le sommeil paisible tant désiré et non procuré par tout types de médicaments. Essentiellement composé de feuille de morphine, ce thé vous assurera d’un rétablissement digne d’un voyage sur . Drosophila. 01/2019. Wilson Leung. Outline. Transcription start sites (TSS) annotation goals. Promoter architecture in . D. melanogaster. Find the initial transcribed exon in the target species. Annotate putative transcription start sites. ChIP-Seq. Processing Tools for . modENCODE. and ENCODE Data. Quang M Trinh. Ontario Institute for Cancer Research. qtrinh@oicr.on.ca. Outline. M. odel . O. rganism . ENC. yclopedia. . O. f . D. NA . protein content has also been found to aect lifespan 23], and this would be increased following a heavy probiotic diet. Furthermore, increased expression of antioxidant enzymes (superoxide dismutase Drosophila . melanogaster. Drosophila Melanogaster, a popular genetic model organism. ~ 50% of fly genes have vertebrate homologs. Small and easy to grow in lab. Short generation time . Produce high amounts of offspring. Figure 8-1. The Cell Cycle Figure 8-2. Metaphase Chromosome 1. A tissue culture is grown from a cell sample (biopsy). White blood cells, bone 2. The tissue cultur Drosophila Medium Ingredients Gms / Litre Brewers yeast, dried 13.300 Corn Meal 133.000 V-8 vegetable juice 180.000 Methyl parahydroxybenzoate 0.093 Agar 13.300 Final pH ( at 25°C) Suspend 3 grams in 2606 frame (ORF) was cloned into the I site of pAc5.1/c-MYC-HISAusing the following PCR primers: AcCYLD-F: 5-CCCGAATTCC A -AAATGATCTTAAACAACAA AAG TAAAAC-3CCCCTCGAGATGGTACATCATTA TATCTGTGC-3MYC-HIS A 73 T. R. Strecker, J. R. Merriam and J. A. LengyelH. PARRY D M & GOULD-SOMERO M (1972)Segmenta aneuploid an th geneti gros structuro th Drosophila genome Genetics 71 157-184LINDSLEY D & ZIMM G (1985) Heredity. Mutations. Experiments. General Characteristics. 100. 100. 100. 100. 100. 200. 200. 200. 200. 200. 300. 300. 300. 300. 300. 400. 400. 400. 400. 400. 500. 500. 500. 500. 500. Developmental Stages for .
Download Document
         Here is the link to download the presentation.
"Overview of the  Drosophila modENCODE hybrid assemblies"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
	 
        
Related Documents

 
         
         
         
         
         
         
         
         
         
         
         
         
        