PPT-Overview of the Drosophila modENCODE hybrid assemblies

Author : hazel | Published Date : 2022-06-11

Wilson Leung 012014 Agenda Overview of the modENCODE species Problems with the version 1 genome assembly Improvements in the version 2 genome assembly Pipeline used

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Overview of the Drosophila modENCODE hy..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Overview of the Drosophila modENCODE hybrid assemblies: Transcript


Wilson Leung 012014 Agenda Overview of the modENCODE species Problems with the version 1 genome assembly Improvements in the version 2 genome assembly Pipeline used to create the sequence improvement projects. According to Gartner by 2017 the public cloud services market is predicted to exceed 244 The Hybrid Cloud Solution Com petency helps partners create opportunities drive pipeline and increase revenues with VMware to address this significant market o “Serving Commercial and Military. Customers for Over . 127 . Years”. 2013. W.H. Smith Company – Corporate Overview. Introduction. Proud Manufacturer of the USMC Hose Reel System (HRS) . and the US Army Assault . 624 . - Developmental Genetics. Lecture . #4 – . Gastrulation. . Movements. . GASTRULATION is a complex series of cell movements that:. --rearranges cells, giving them new neighbors. --results in the formation of 3 GERM LAYERS that will form the subsequent embryo: ectoderm, endoderm and mesoderm. BTEC Applied Science. Unit 18: Genetics. Assignment 3: Inheritance. Starter Quiz. For Each question, write down the answer in your notes…. Question 1:. Which is the Male fly?. A. B. Question 2. What mutation is this fly displaying?. ABSTRACT Function in Drosophila melanogaster Duke University Date:_______________________ Approved: ___________________________ Daniel P. Kiehart, Supervisor ___________________________ Daniel J. Lew Drosophila. 01/2019. Wilson Leung. Outline. Transcription start sites (TSS) annotation goals. Promoter architecture in . D. melanogaster. Find the initial transcribed exon in the target species. Annotate putative transcription start sites. Orb2 dependent . long-term memory maintenance in Drosophila . Natalie . Galles. S. N. Bose Research Exchange. Summer 2016. Lab 11 . nccs. – . pune. Internship at NCCS, Pune. Spent my 8 weeks working in Lab 11 under direction of Dr. . ChIP-Seq. Processing Tools for . modENCODE. and ENCODE Data. Quang M Trinh. Ontario Institute for Cancer Research. qtrinh@oicr.on.ca. Outline. M. odel . O. rganism . ENC. yclopedia. . O. f . D. NA . for. . IRTMTC/ALD. by. IRICEN. BCM ASSEMBLIES . 1. Excavating Chain. Shovel or main link - 82 Nos.. Intermediate link - 82 Nos.. Chain finger - 5 Nos. in each shovel total 410 Nos.. Chain bolt - 2 Nos.. Figure 8-1. The Cell Cycle Figure 8-2. Metaphase Chromosome 1. A tissue culture is grown from a cell sample (biopsy). White blood cells, bone 2. The tissue cultur 2606 frame (ORF) was cloned into the I site of pAc5.1/c-MYC-HISAusing the following PCR primers: AcCYLD-F: 5-CCCGAATTCC A -AAATGATCTTAAACAACAA AAG TAAAAC-3CCCCTCGAGATGGTACATCATTA TATCTGTGC-3MYC-HIS A 73 T. R. Strecker, J. R. Merriam and J. A. LengyelH. PARRY D M & GOULD-SOMERO M (1972)Segmenta aneuploid an th geneti gros structuro th Drosophila genome Genetics 71 157-184LINDSLEY D & ZIMM G (1985) External Reviewer, Developmental Biology Programme, European Molecular &2003 Biology Laboratory, Heidelberg, Germany 2000, 2003, Member External Advisory Board of the Department of Biological Scie Heredity. Mutations. Experiments. General Characteristics. 100. 100. 100. 100. 100. 200. 200. 200. 200. 200. 300. 300. 300. 300. 300. 400. 400. 400. 400. 400. 500. 500. 500. 500. 500. Developmental Stages for .

Download Document

Here is the link to download the presentation.
"Overview of the Drosophila modENCODE hybrid assemblies"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents