PPT-Drosophila Jeopardy Developmental Stages
Author : hadly | Published Date : 2024-03-15
Heredity Mutations Experiments General Characteristics 100 100 100 100 100 200 200 200 200 200 300 300 300 300 300 400 400 400 400 400 500 500 500 500 500 Developmental
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Drosophila Jeopardy Developmental Stage..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Drosophila Jeopardy Developmental Stages: Transcript
Heredity Mutations Experiments General Characteristics 100 100 100 100 100 200 200 200 200 200 300 300 300 300 300 400 400 400 400 400 500 500 500 500 500 Developmental Stages for . What is High-Dynamic-Range Image?. http://en.wikipedia.org/wiki/High-dynamic-range_imaging. Single-Jeopardy. What is the use of Bayer Pattern?. To reduce the manufacture cost (from 3-CCD to single-CCD). Robin Sturm. Who is Watson?. This is Watson!. (His “face” at least). This is also Watson. What. is Watson?. A computer developed by IBM to play Jeopardy!. Watson was IBM’s next “Grand Challenge” after Deep Blue defeated Garry Kasparov in a chess tournament in 1997.. 624 . - Developmental Genetics. Lecture . #4 – . Gastrulation. . Movements. . GASTRULATION is a complex series of cell movements that:. --rearranges cells, giving them new neighbors. --results in the formation of 3 GERM LAYERS that will form the subsequent embryo: ectoderm, endoderm and mesoderm. ABSTRACT Function in Drosophila melanogaster Duke University Date:_______________________ Approved: ___________________________ Daniel P. Kiehart, Supervisor ___________________________ Daniel J. Lew Erik Erikson. Psychosocial . Psyco. = psychological . Social = environment. Interaction of both. Reciprocal relationship . Erikson put together 8 stages of development. Stages = crisis to be resolved for that stage of development. Career patterns. As people mature, they go through changes.. Career patterns are determined by:. Socioeconomic factors. Mental and physical abilities. Personal characteristics. Opportunities of exposure. Developmental stages of humans. Fertilization. Zygote. It is a fertilized . egg . Diploid (2n). Female . pronuclei. Male . pronuclei. Amphimixis. Developmental stages of humans. Zona. . pellucida. Surrounds the zygote. Developmental stages of humans. Fertilization. Zygote. It is a fertilized . egg . Diploid (2n). Female . pronuclei. Male . pronuclei. Amphimixis. Developmental stages of humans. Zona. . pellucida. Surrounds the zygote. Orb2 dependent . long-term memory maintenance in Drosophila . Natalie . Galles. S. N. Bose Research Exchange. Summer 2016. Lab 11 . nccs. – . pune. Internship at NCCS, Pune. Spent my 8 weeks working in Lab 11 under direction of Dr. . PhDResearch Assistant Professor Laboratory of Human GeneticsSchool of Food and Nutritional Sciences University of ShizuokaTel 81-54-264-5226Email y-ohharau-shizuoka-kenacjpEducationDoctor of Philosop ADRC 2014, San Diego. In this talk….. Why human disease models?. The data so far. Searching human disease model data. What’s next?. . 1993. 1998. 2003. 2008. 2013. Drosophila papers containing “disease” in the abstract or title. An introduction to web tools, . databases, and NCBI BLAST. Wilson Leung 12/2021. Agenda. GEP annotation project overview. Web databases for . Drosophila. annotation. UCSC Genome Browser. NCBI / BLAST. Mutant organisms. What is a mutant organism?. An organism with a permanent change to its genome. What are mutants used for in research?. Expression of a fluorescent protein in a single pair of neurons . 2606 frame (ORF) was cloned into the I site of pAc5.1/c-MYC-HISAusing the following PCR primers: AcCYLD-F: 5-CCCGAATTCC A -AAATGATCTTAAACAACAA AAG TAAAAC-3CCCCTCGAGATGGTACATCATTA TATCTGTGC-3MYC-HIS A
Download Document
Here is the link to download the presentation.
"Drosophila Jeopardy Developmental Stages"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
