PPT-K ey issues in publishing and consuming linked data for lib
Author : celsa-spraggs | Published Date : 2016-07-15
Gordon Dunsire Presented to CILIP Linked Data Executive Briefing 24 November 2015 London Overview Linked data 101 Linked data vocabularies Local vs global Eating
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "K ey issues in publishing and consuming ..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
K ey issues in publishing and consuming linked data for lib: Transcript
Gordon Dunsire Presented to CILIP Linked Data Executive Briefing 24 November 2015 London Overview Linked data 101 Linked data vocabularies Local vs global Eating cake Item is Person by purchased. brPage 1br Consuming raw or undercooked meat poultry shellf ish or eggs may increase your risk of food borne i llness brPage 3br Notice Consuming raw or undercooked meats poultry seafood shel lfish eggs may increase your risk of foodborne illness brPage 4br Notice Consuming raw or undercooked meats poultry seafood shel lfish eggs may increase your risk of foodbor brPage 1br CONSUMING RAW OR UNDERCOOKED MEATS POULTRY SEAF OOD SHELLFISH OR EGG MAY INCREASE YOUR RISK OF FOO D BORNE ILLNESS Home Style Chicken Dumpling Soup 8 Black Eyed Pea and Tomato Sou Survey of Popular Culture. Consuming Passions: The Culture of American Consumption. Survey of Popular Culture. Chapter 1. Consuming Passions: The Culture of American Consumption. Laurence . Shames. , . CS255971A Arizona ►1 linked to cream facility Oklahoma ►1 linked to cream facility Listeria found cream products Oklahoma facility where they were made LISTERIA AND BLUE BELL ICE CREAM Module 1 - . Part . 1. The . Semantic Web and Linked Data . Concepts: . A . basic overview . . 1-. 1. Library of . Congress. BIBFRAME Pilot Training . for Catalogers. Overview. Context . Goals . of the . Chapter 3. 1. 2. Data Abstraction. separates the logical properties of . a data . type from its . implementation. LOGICAL PROPERTIES. What. are the possible values? . What. operations will be needed?. SMP and Embedded Real Timehttp://0-delivery.acm.org.innopac.lib.ryerson.ca/10.1145/1200000/11...5 of 108/27/2007 7:26 PMFigure 3. Hard real time: sometimes system failure is not an option!If these res Ted Lawless. Code4Lib . 2016 – March 8. th. , 2016. Abstract. Libraries, archives, and museums have begun publishing Linked Open Data (LOD). Yet for many technical teams working in these organizations, the path towards implementing tools or services that both benefit users and utilize LOD remains elusive or out of reach. This talk will walk the audience through identifying and creating a useful, lightweight "identity hub" of academic journals. It will cover interlinking multiple sources of data and publishing as LOD using a Linked Data Fragments (LDF) server, and embedding useful contextual information in existing web pages. All data and code used to produce the "identity hub" will be shared. The principles of interlinking and publishing will be applicable to other types of data. R. evised based on textbook author’s notes.. Doubly linked lists. A linked list in which each node contains a data component(s) and two links: . one pointing the next node and . one pointing to the preceding node.. Module 1 - . Part . 1. The . Semantic Web and Linked Data . Concepts: . A . basic overview . . 1-. 1. Library of . Congress. BIBFRAME Pilot Training . for Catalogers. Overview. Context . Goals . of the . Heaps. Hashes. Data Structures. 10. Stack - Overview. Stack - Prosperities. La. st . in First Out. Memory with access only to the top element. 2 stacks can act as one Random Access Memory. Inserts . (. Cultivating relationships with journal editors and staff. by Marianne Reed and Brian Rosenblum. 1. www.lib.ku.edu. Digital Publishing Services. Our journal publishing program started in 2007. Two platforms support a variety of publishing models. grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01ForalltxtNextextractallthereadsinthenew28lewithexactly10charactersbeforetheprimerandthenallthereadsinthenew28lewithoutexactly10bpbeforetheprimergrep16Forw
Download Document
Here is the link to download the presentation.
"K ey issues in publishing and consuming linked data for lib"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents