PDF-Probabilistic Reconstruction of Ancestral Gene Orders with Insertions and Deletions Fei
Author : celsa-spraggs | Published Date : 2015-02-01
Inferring the gene order of an extinct species has a wide range of applications including the potential to reve al more detailed evolutionary histories to determine
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Probabilistic Reconstruction of Ancestra..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Probabilistic Reconstruction of Ancestral Gene Orders with Insertions and Deletions Fei: Transcript
Inferring the gene order of an extinct species has a wide range of applications including the potential to reve al more detailed evolutionary histories to determine gene co ntent and ordering and to understand the consequences of st ructural changes. Rs 000Item No.(Jan-Dec)Actual 2015/16(Jul-Jun)Estimates2016/17(Jul-Jun)Planned2017/18(Jul-Jun)Planned22Goods and Services 16,143 13,000 15,000 15,000 22900Ot Jin Zhang . and . Yufeng. Wu. Department of Computer Science and Engineering. University of Connecticut. Introduction. R. eference. A. lternative. deletion. insertion. Structural variants. low . coverage . in the Human Genome Philipp W. Messer GeneticVariation CGACAATAGCGCTCTTACTACGTGTATCG |||||||:||||| ||||||||:|||| CGACAATGGCGCT---ACTACGTGCATCG 1.Nucleotide mutations 2.Genomic rearrangements 3.DNA i X–H insertion reactions based on . carbenoids. Speaker: . Shaolong. Zhang. Supervisor: David . Zhigang. Wang. Date: Jan. . 3. nd. , 2014. 1. Outline. Background. Construction of C-X bond via metal . Spring 2011. Constantinos (. Costis. ) Daskalakis. costis@mit.edu. lecture 23. Phylogenetic. Reconstruction. Theorem [Lecture 21] :. independent samples from the CFN model. suffice to reconstruct the . SWBAT. the major political, economic, and cultural developments in Tang and Song China and their impact on Eastern Asia. (4H). The Tang and Song Dynasties of China. Like Western Europe . after . the decline of the . Team 7-Jun 1 21 21 21 3 0 0 0 5 21 21 21 2111513421212168610 14-Jun 3 13 21 21 2 17 21 21 1 16 11 23 621161142115175212122 21-Jun 6 21 21 21 5 21 21 19 1 21 21 21 400021213213191715 28-Jun 4 21 21 2 Introduction. Use the readings at your table to make notes on your Venn diagram about the Tang or Song Dynasty. . Together we will share out and compile a Venn Diagram comparing/contrasting the 2 Dynasties.. The Tang Dynasty (618 – 907 C.E.). A golden age of culture in Chinese history. Unified over a vast territory. At the end of it’s reign, ruled over around 80,000,000 people. Received influences in the arts through trade from areas like India, the Middle East, Central Asia, and Persia. Reunification and Renaissance. 220 CE.—Han dynasty ends. 220-589—Era of Division. 589-618—Sui dynasty. 618-907—Tang dynasty. 960-1279—Song dynasty. 1279-1368—Mongol (Yuan) dynasty. Rebuilding the Imperial Edifice. China made great advances in art, literature, architecture, and technology under the rule of the Tang and Song. Do Now:. What Chinese philosophy was reflected in the Tang government?. . Chinese Empires. Global I: Spiconardi. Sui Dynasty (581 C.E. – 618 C.E.). Sui. In 581 C.E., Yang . Jian. (Emperor . Wen. ) reunites China by founding the Sui Dynasty. The Sui supported both Buddhism & Daoism. Emperor . TANG DYNASTY Rulers were reform minded If they increased the government’s ability to administrate, they would increase their power. Restored the Civil Service exams. - Gave the Tang a pool of competent bureaucrats to administrate the government The functional importance of the approximately 98% of mammalian genomes not corresponding to protein coding sequences remain largely unscrutinized . To test experimentally whether some extensive regio
Download Document
Here is the link to download the presentation.
"Probabilistic Reconstruction of Ancestral Gene Orders with Insertions and Deletions Fei"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents