PDF-DNA Insertions and Deletions

PDF-DNA Insertions and Deletions thumbnail
in the Human Genome Philipp W Messer GeneticVariation CGACAATAGCGCTCTTACTACGTGTATCG CGACAATGGCGCTACTACGTGCATCG 1Nucleotide mutations 2Genomic rearrangements 3DNA

Download Presentation

Download Note : "DNA Insertions and Deletions" is the property of its rightful owner. Permission is granted to download and print materials on this website for personal, non-commercial use only, provided you retain all copyright notices. By downloading content from our website, you accept the terms of this agreement.

Presentation Transcript

Transcript not available.

Related Topics