PDF-DNA Insertions and Deletions

Author : lois-ondreau | Published Date : 2016-04-28

in the Human Genome Philipp W Messer GeneticVariation CGACAATAGCGCTCTTACTACGTGTATCG CGACAATGGCGCTACTACGTGCATCG 1Nucleotide mutations 2Genomic rearrangements 3DNA

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "DNA Insertions and Deletions" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

DNA Insertions and Deletions: Transcript


Download Rules Of Document


"DNA Insertions and Deletions"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents