/
DNA  Strand Polarity, Transcriptional Orientation, Numbering Conventions DNA  Strand Polarity, Transcriptional Orientation, Numbering Conventions

DNA Strand Polarity, Transcriptional Orientation, Numbering Conventions - PowerPoint Presentation

cheryl-pisano
cheryl-pisano . @cheryl-pisano
Follow
380 views
Uploaded On 2018-03-15

DNA Strand Polarity, Transcriptional Orientation, Numbering Conventions - PPT Presentation

Hardison Genomics 112 1 1817 Different polarity for the two strands of DNA 1817 2 AGCCTCGCAT TCGGAGCGTA 5 5 The sequence of each strand is the reverse complement of the other ID: 651508

strand sequence dna position sequence strand position dna bottom duplex gcgtttctgaaagagttgctgtgggaagatgtggagacttctctgtaaaccttccagact top cgcaaagactttctcaacgacacccttctacacctctgaagagacatttggaaggtctga nucleotides rna exercise left reading starting

Share:

Link:

Embed:

Download Presentation from below link

Download Presentation The PPT/PDF document "DNA Strand Polarity, Transcriptional Or..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript