/
Development of the Theophylline Development of the Theophylline

Development of the Theophylline - PowerPoint Presentation

danika-pritchard
danika-pritchard . @danika-pritchard
Follow
369 views
Uploaded On 2017-01-25

Development of the Theophylline - PPT Presentation

Riboswitch 1 on 2 Meeting 090313 Original Riboswitch Design Desaia and Gallivan 2004 5GGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACC3 ATG TGA B galactosidase Translated Region ID: 513852

riboswitch rbs results aptamer rbs riboswitch aptamer results riboswitches free energy region candidates spacers fold 536 rbs

Share:

Link:

Embed:

Download Presentation from below link

Download Presentation The PPT/PDF document "Development of the Theophylline" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.


Presentation Transcript