6session practical course Genomics into Medicine Session 1 Essential genetics and genomics for clinical practice Dr Polona Le Quesne Stabej University of Auckland 2pm May 27 th 2022 Session 2 ID: 1041101
Download Presentation The PPT/PDF document "Genomics for Cancer Clinicians" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
1. Genomics for Cancer Clinicians6-session practical courseGenomics intoMedicine
2. Session 1Essential genetics and genomics for clinical practiceDr Polona Le Quesne Stabej, University of Auckland 2pm, May 27th 2022Session 2Practical variant interpretationDr Polona Le Quesne Stabej, University of Auckland 2pm, June 3rd 2022Session 3Using next generation genomic testsDr Sandra Fitzgerald, University of Auckland 2pm, June 10th 2022 Session 4Cancer biology matters for precision oncologyDr Ana Ramachandran, University of Auckland 2pm, July 8th 2022Session 5Inherited Cancer PredispositionDr Alex Henderson, Auckland District Health Board2pm, July 15th 2022Session 6Interactive session2pm, July 22nd 2022Schedule
3. AcknowledgementsThis course is the work of a large team:Cris PrintBen LawrencePolona Le Quesne StabejSandra FitzgeraldAlex HendersonAna RamachandranTamsin RobbThierry LintsKimi HenareVicky FanAlice MinhinnickSylvie ChanNadia HitchenAngela MweempwaSanjeev DevaJames Opie
4. Cancer Biology in Precision OncologyDr. Anassuya RamachandranSession 4:
5. Session 4: Cancer Biology in Precision OncologyCase OverviewHallmarks of CancerTumour Evolution and Clonal HeterogeneityEmergence of Therapy Resistance
6. 2021Colorectal cancer,liver mets. Folfoxiri+bevacizumabLesions sig. reducedEncorafenib, binimetinib, cetuximabFolfoxiri+bevacizumabBRAF V600ESampled - tissueliver mets.Foundation One CDx tissueBRAF V600ENRAS Q61HBRIP1 R798*MET – amplificationTP53 559+2T>G (splice)Foundation OneLiquid CdxBRAF V600EBRAF exons 2-10 deletionBRIP1 R798*TP53 559+2T>G (splice)Sampled – blood/plasmactDNAProgressing liver mets and- bone mets20202019Reduction of primary+liver metsLiver lesions increasedEncorafenib, cetuximabLiver lesion increased43 yo maleMetastatic CRC
7. The Biology of CancerCancer is a multistep process where cells:Acquire functional capabilities that permit unrestrained cell growthShare features with embryonic development and wound healingTumours are complex, three-dimensional tissuesHanahan, D. and Weinberg, R.A. 2011. Cell. 144: 646-674Cancer cells must implement a series of adaptive stages to successfully metastasise
8. Hanahan, D. and Weinberg, R.A. 2011. Cell. 144: 646-674Concepts are shared by many cases but the detail is unique to the individualHallmarks of CancerDistilled into the hallmarks of cancer:
9. Proto-oncogene – wildtype version of the gene prior to mutation (e.g. BRAFWT, KRASWT, EGFRWT)Specific amino acids are mutated to confer gain of functionTumour suppressor gene – a gene whose protein product keeps cell proliferation in checkMutations are loss of function and tend to be distributed throughout the geneOncogenes and Tumour Suppressor GenesOncogene – mutated gene that has the potential to cause cancer (e.g. BRAFV600E)BRAF mutations in COSMICTP53 mutations in COSMIC
10. Drivers play a significant role in driving tumourigenesisPassengers have a negligible effect on cancer cell fitness at a particular timeThis binary classification is not perfect:Multiple passenger mutations can work in concert/substitute for driversOncogenes and Tumour Suppressor GenesFor both classes of genes, mutations are classified as drivers or passengers:Distinction between drivers and passengers is dynamic and can change over time
11. Cell proliferationSenescenceCell deathTumour suppressorOncogeneCell proliferationSenescenceCell deathTumour suppressorOncogeneCell proliferationSenescenceCell deathTumour suppressorProto-oncogeneCell proliferationSenescenceCell deathTumour suppressorProto-oncogeneCell proliferationSenescenceCell deathTumour suppressorProto-oncogeneCell proliferationSenescenceCell deathTumour suppressorOncogeneOncogenes and Tumour Suppressor GenesProliferative signals and growth suppressive signals are balanced in normal homeostasis
12. Oncogenes and Tumour Suppressor Genes
13. Questions?
14. Hanahan, D. and Weinberg, R.A. 2011. Cell. 144: 646-674Hallmarks of Cancer
15. Sustaining Proliferation, Evading Growth Suppressors and Resisting Cell DeathMechanisms to promote proliferation:Activation of receptor tyrosine kinase (RTK) pathwaysActivation of cell cycle progression regulatorsMechanisms to evade growth suppressors:Loss of TP53Loss of cell cycle inhibitorsApoptosis is a strong barrier to oncogenesisCircumvented by loss of TP53 and other pro-apoptotic factors, gain of anti-apoptotic factorsMaher, E.A. et.al. 2001. Genes Dev. 15:1311-1333
16. Sustaining Proliferation, Evading Growth Suppressors and Resisting Cell DeathGRB-2SOSRASBRAFMEKERKCell proliferationBRAFA RTK cascade is an oncogenic pathway can be activated and targeted at multiple pointsMutation of downstream signalling componentsLoss of negative regulators of the pathwayReceptor overexpressionReceptor mutationLigand overexpressionMechanisms of activationEncorafinibRegorafinibBinimetinibBevacizumabCetuximabIntervention strategies
17. Questions?
18. Hanahan, D. and Weinberg, R.A. 2011. Cell. 144: 646-674Hallmarks of Cancer
19. Inducing AngiogenesisVEGF is a potent angiogenic ligand; other ligands include FGFsVasculature is mostly quiescent in adult tissues but is almost always activated in cancer (“angiogenic switch”)Angiogenesis is essential for tumourigenesisVascular mimicry also occurs in tumoursTumour vasculature is highly disorganisedCarmeliet, P. and Jain, R.K. 2011. Nat. Rev. Drug. Discov. 10: 417-427
20. Hanahan, D. and Weinberg, R.A. 2011. Cell. 144: 646-674Hallmarks of Cancer
21. Enabling Replicative ImmortalityTelomeres are ends of chromosomesMaintain chromosome stabilityTracker of number of cell divisionCancer cells maintain their telomeres by re-expressing telomerase or by alternative lengthening of telomeresShorten with each cell divisionRai, R. et.al. 2016. Nature Comms. 7: 10881Soudet, J. et.al. 2014. Mol. Cell. 53: 954-964
22. Questions?
23. Hanahan, D. and Weinberg, R.A. 2011. Cell. 144: 646-674Hallmarks of Cancer
24. Genomic Instability and MutationNormal cells have mechanisms in place to limit the amount of damage in each cell divisionLoss of telomeres, DNA repair pathways proteins removes DNA error correction abilitiesAllows the accumulation of mutations in cancer cellsMeasured by microsatellite instability, tumour mutational burden (MSI, TMB)Functional telomeres, DNA repair pathways like mismatch repair (e.g. MSH2, MLH1, PMS2), homologous recombination (e.g. BRCA1/2, PALB2, RAD51, BRIP1)
25. Genomic Instability and MutationCACACACACACACACACACACACACACACACACACACACACACACACADNA replication with errorsCACACACACACACACACACACACACACACACACACACACACACACACAMismatch repair intactMismatch repair lostMicrosatellite stableMSSProficient Mismatch repair/pMMRMicrosatellite instabilityMSI-HighDeficient mismatch repair/dMMRMicrosatellite position (locus)Microsatellite instability
26. Genomic Instability and MutationTumour mutation burden (TMB)3’-TAGTTGCATATCGATCTACTCTAGATCGTGGCTAATCTAGAGCTGTTGA……………………………TTGGTACTGTACCTGAGCATG-5’1 MB of sequence5’-ATCAACGTATAGCTAGATGAGATCTAGCACCGATTAGATCTCGACAACT……………………………AACCATGACATGGACTCGTAC-3’TMB: 0 mutations/MB5’-ATCAACGgATAGCTAGATGAGATCTAGCACCGATTAGATCTCGACAACT……………………………AACCATGACATGGACTCGTAC-3’TMB: 1 mutation/MB5’-AaCAACGgATAGCTcGATGAGATCTAGCtCCGATTAGATCTCGAtAACT……………………………AACCATGACATGGACTCGTAC-3’TMB: 5 mutations/MB5’-AaCAACGgATAGCTcGATGAaATCgAGCtCCGATTAGtTCTCGAtAACT……………………………AACCAaGACATGaACTCtTAg-3’TMB: 12 mutations/MBNumber of somatic mutations per megabase (one million bases) of coding DNA
27. Genomic Instability and MutationMutations provide the background on which tumour evolution worksMMR status (MSS vs MSI/MSI-High) and TMB are used as surrogate markers for neoantigen loadMay also increase the neoantigen load of cancer cellsYarchoan, M. et.al. 2017. Nat. Rev. Cancer. 17: 209-222
28. Questions?
29. Hanahan, D. and Weinberg, R.A. 2011. Cell. 144: 646-674Hallmarks of Cancer
30. Immune Response in CancerMost tumours are infiltrated by immune cellsCells of the innate immune system – macrophages, natural killer cellsCells of the adaptive immune system – tumour infiltrating lymphocytes (TILs)Both immunostimulatory and immunosuppressivePart of the immune response in tumour promoting – sustains proliferation, limits cell death, modifies the extracellular matrixSome cancers are intimately linked with infections:Gastric cancer and Helicobacter pyloriLiver cancer and Hepatitis CCervical cancer and Human Papilloma Virus
31. Immune Response in CancerPart of the immune response is attempts at tumour eradicationResponsible for cancer immunoeditingTumours have variable amounts and pattern of infiltration of CD8+ T cellsGalon, J. and Bruni, D. 2019. Nat. Rev. Drug. Discover. 18: 197-218Immune suppressedHotImmune excludedCold
32. Immune CheckpointsStrong pathways exist to prevent immune rejection of self and limit immune responsesImmune checkpointsCancer cells co-opt these to avoid immune destructionde Mello R.A. et.al. 2017. Onco Targets Ther. 10:21-30Tumours with immune checkpoint activation may benefit from by immune checkpoint inhibitors (ICI)
33. TMB, Immune Infiltration and Immune Checkpoint InhibitorsImmunologically hot tumours are likely to benefit from ICIResponse to ICI modified by other factors:Benefit from ICIImmune suppressedHotImmune excludedColdGalon, J. and Bruni, D. 2019. Nat. Rev. Drug. Discover. 18: 197-218Tumour microenvironmentNeoantigen load (MMR status, TMB)
34. Prognostic value of TILs may be linked to TMBModified from Thomas, A. et. al. 2018. Oncoimmunology. 7: e1490854HotImmune suppressed/ excludedColdTMB, Immune Infiltration and Immune Checkpoint Inhibitors
35. TMB, Immune Infiltration and Immune Checkpoint InhibitorsdMaleki Vareki, S. 2018. J Immunother Cancer. 6:157
36. Questions?
37. Hanahan, D. and Weinberg, R.A. 2011. Cell. 144: 646-674Hallmarks of Cancer
38. Altered Cellular MetabolismMany metabolic pathways deregulated in cancer e.g. glutaminolysis, electron transport chainAltered pathways generate metabolic intermediates that are used as substrates by cancer cellsAlso impact other cellular processes e.g. DNA methylation, chromatin modificationGlucose metabolism is a key metabolic pathway that is altered in cancerCancer cells almost always metabolise glucose poorly even in the presence of oxygen (generate 4 ATP/glucose molecule)Vander Heiden, M.G. et.al. 2009. Science. 324: 1029-1033
39. Questions?
40. Clonal Heterogeneity and Tumour EvolutionCancer cells undergo Darwinian selection but are evolving in an expanding populationGenetic drift may play a significant roleTumours may have relatively low rates of evolution punctuated by periodic jumps (saltatory evolution) Tumour evolution is often branched and not linear
41. (Modified from Perelman School of Medicine, University of Pennsylvania)BRAFV600EBRAFV600E, NRASQ61HBRAFV600E, BRIP1R798*,BRAFΔEx2-10TimeClonal Heterogeneity and Tumour EvolutionBRAFV600E, BRIP1R798*
42. Clonal Heterogeneity and Tumour EvolutionTiming of genomic test and material sampled are important and should be active choicesTherapy applies a strong selective pressure on cells
43. Questions?
44. 2021Colorectal cancer,liver mets. Folfoxiri+bevacizumabLesions sig. reducedEncorafenib, binimetinib, cetuximabFolfoxiri+bevacizumabBRAF V600ESampled - tissueliver mets.Foundation One CDx tissueBRAF V600ENRAS Q61HBRIP1 R798*MET – amplificationTP53 559+2T>G (splice)Liver lesion increasedFoundation OneLiquid CdxBRAF V600EBRAF exons 2-10 deletionBRIP1 R798*TP53 559+2T>G (splice)Sampled – blood/plasmactDNAProgressing liver +bone mets20202019Reduction of primary + liver metsLiver lesions increasedEncorafenib, cetuximab43 yo maleMetastatic CRC
45. BRAFWT must dimerise for signalling; R509 is essential for dimerisationBRAFV600E common in multiple cancer types, including colorectal cancerGRB-2SOSRASBRAFpMEKpERKCell proliferationBRAFR509R509Modified from Rajakulendran, T. et.al. 2009. Nature. 461: 542-546RTKBRAF Dependent Oncogenesis
46. BRAFV600E Acts as a MonomerGirtman, M.A. et.al. 2021. BioRxiv. doi: https://doi.org/10.1101/2021.07.22.453427Joseph, E.W. et.al. 2010. PNAS. 107: 14903-14908BRAF Dependent OncogenesispMEK1/2Vemurafenib
47. GRB-2SOSRASBRAFpMEKpERKCell proliferationActivated by VemurafenibBRAFRTKGRB-2SOSRASpMEKpERKCell proliferationSensitive to VemurafenibBRAFV600ERTKGRB-2SOSRASpMEKpERKCell proliferationResistant to VemurafenibBRAFV600E:ΔExonsRTKBRAFV600E:ΔExonsBRAF Dependent OncogenesisBRAFWT - dimerBRAFV600E - monomerBRAFV600E:ΔInternal Exons – dimer
48. BRAFΔInternal Exons are a common mechanism of resistance to BRAFV600E inhibitorsPoulikakos, P.I. et.al. 2011. Nature. 480: 388-391.Tung, J.K. et.al. 2020. Cold Spring Harb Mol Case Stud. 6: a005140Melanoma patients who progressed on VemurafenibBRAF Dependent OncogenesisCRC patient who progressed on Vemurafenib
49. 2021Colorectal cancer,liver mets. Lesions sig. reducedEncorafenib, binimetinib, cetuximabBRAF V600EBRAF V600EBRAF exons 2-10 deletionBRIP1 R798*TP53 559+2T>G (splice)Progressing liver +bone mets20202019Encorafenib, cetuximabOncogeneDriver mutationTumour suppressor genesDNA repair pathwaysTumour evolutionAcquired resistanceTargetingangiogenesisFolfoxiri+bevacizumabTargeting RTK signalling
50. Thank you and feedback welcome!Anassuya Ramachandrananassuya.ramachandran@auckland.ac.nz