Gavin Buckley Supervisor Dr Malgorzata Krajewska School of Biochemistry and Cell Biology University College Cork 1 Transcriptional CyclinDependent Kinases CDK12 Promotes transcription elongation ID: 1043910
Download Presentation The PPT/PDF document "Cyclin-Dependent Kinase 12 as a Therapeu..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
1. Cyclin-Dependent Kinase 12 as a Therapeutic Target in the Treatment of Breast Cancer Gavin BuckleySupervisor: Dr. Malgorzata KrajewskaSchool of Biochemistry and Cell Biology, University College Cork 1
2. Transcriptional Cyclin-Dependent Kinases CDK12Promotes transcription elongation.Regulates the expression of DDR genes such as BRCA1.Frequently altered expression in breast cancer – promotes tumour growth. 2
3. Objectives 3Computational analysis of CDK12 expression in breast cancer.Produce pLKO.1-TRC plasmids containing shCDK12 constructs.Analyse the ability of these modified plasmids to knockdown CDK12 – and consequently knockdown BRCA1.
4. CDK12 expression in breast cancer 4Source: R2Source: cBioPortal
5. pLKO.1-TRC cloning vector 5
6. Overview of methodology 1. Amplification and purification of pLKO.1-TRC and shScramble2. Digestion of pLKO.1-TRC plasmid3. Annealing forward and reverse oligos (shRNA construct)4. Ligation of shRNA construct and digested vector 5. Screening for positive clones – Validated by sequencing 6. Production of lentiviral particles and transfection of breast cancer cells 7. Western blot Source: BioRender6
7. pLKO.1-TRC plasmid digestion with AgeI and EcoRI Source: Addgene7
8. Annealing forward and reverse shCDK12 oligos shCDK12_A_FwCCGGGCACTGAAAGAGGAGATTGTTCTCGAGAACAATCTCCTCTTTCAGTGCTTTTTGshCDK12_B_FwCCGGCAGTTCACGCAGTCGTCATTCCTCGAGGAATGACGACTGCGTGAACTGTTTTTGshCDK12_C_FwCCGGGAAGTAGAAGTCCTGCATATTCTCGAGAATATGCAGGACTTCTACTTCTTTTTGshCDK12_D_FwCCGGGCTCGGCTCTATAACTCTGAACTCGAGTTCAGAGTTATAGAGCCGAGCTTTTTGshCDK12_E_FwCCGGGATCGATGAAGGACCGGATATCTCGAGATATCCGGTCCTTCATCGATCTTTTTGshCDK12_A_RvAATTCAAAAAGCACTGAAAGAGGAGATTGTTCTCGAGAACAATCTCCTCTTTCAGTGCshCDK12_B_RvAATTCAAAAACAGTTCACGCAGTCGTCATTCCTCGAGGAATGACGACTGCGTGAACTGshCDK12_C_RvAATTCAAAAAGAAGTAGAAGTCCTGCATATTCTCGAGAATATGCAGGACTTCTACTTCshCDK12_D_RvAATTCAAAAAGCTCGGCTCTATAACTCTGAACTCGAGTTCAGAGTTATAGAGCCGAGCshCDK12_E_RvAATTCAAAAAGATCGATGAAGGACCGGATATCTCGAGATATCCGGTCCTTCATCGATCForward oligosReverse oligos 8shRNA construct Source: Sigma
9. Ligation of digested pLKO.1-TRC vector with shRNA construct 9Source: BioRender shRNA constructDigested plasmidModified plasmidDNA ligase
10. Transformation of bacterial cells with pLKO.1-shCDK12 plasmids No ligase (control 2) shCDK12A constructNo oligo (control 1) 10
11. Screening for inserts (1) Digestion with EcoRI/NcoI11
12. Screening for inserts (2) 12
13. Validation by sequencingE4 insert - CCGGGATCGATGAAGGACCGGATATCTCGAGATATCCGGTCCTTCATCGATCTTTTTG13
14. Transfecting target cells with lentiviral particles containing shCDK12 plasmidsshCDK12 plasmid Packaging plasmid (psPAX2)Envelope plasmid (pMD2.G)Lentiviral production and transfection of MDA-MB-231 cells performed by Patrycja Domeracka MDA-MB-231 cell line Selected on puromycin14Sources: Addgene BioRender
15. Protein expression analysis of MDA-MB-231 cell line transfected with shCDK12 plasmids Sources: BioRender LI-COR Biosciences 151 2 3 4
16. Conclusion – What does this mean? 16Targeting CDK12 expression could provide a therapeutic route for breast cancer patients with limited treatment options. Depleting the expression of BRCA1 has profound implications in improving the effectiveness of DNA-damaging anti-cancer therapies. These findings highlight the importance of developing CDK12 inhibitors capable of entering clinical trials for the treatment of breast cancer patients.
17. Acknowledgements Dr. Malgorzata KrajewskaPatrycja Domeracka Thank you 17