PPT-kb EC1000 MC1061 Gel of PCR Results Using
Author : kampsta | Published Date : 2020-08-27
repA primers pWV01 RSDWV rep F GAGTTTGGGCGTATCTATGGC RSDWV rep R CCCGTTTCAGCATCAAGAACC This was a colony PCR producing an expected 600 bp amplicon PCR conditions
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "kb EC1000 MC1061 Gel of PCR Results Usin..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
kb EC1000 MC1061 Gel of PCR Results Using: Transcript
Download Rules Of Document
"kb EC1000 MC1061 Gel of PCR Results Using"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
