PPT-1st & 2nd Samuel

Author : kittie-lecroy | Published Date : 2020-01-05

1st amp 2nd Samuel Dig Site 17 Blue Level Questions What did the Jebusites say to David when he and his men came to attack them 56 I hope you do not get in Even

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "1st & 2nd Samuel" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

1st & 2nd Samuel: Transcript


1st amp 2nd Samuel Dig Site 17 Blue Level Questions What did the Jebusites say to David when he and his men came to attack them 56 I hope you do not get in Even the blind and lame can ward you off. Samuel 289 WTT 1 Samuel 28 WTT 1 Samuel 29 BHT 1 S uel 28 BHT 1 S uel 29 XT 1 S muel 28 XT 1 S muel 29 XE 1 S muel 28 He l fts up the poor fro he earth nd raises he nee fr he dunghi l to seat h th he prince And Saul and the men of Israel were gathered, and encamped in the Valley of . Elah. , and drew up in line of battle against the Philistines. . 3 . And the Philistines stood on the mountain on the one side, and Israel stood on the mountain on the other side, with a valley between them. . Now . King David was told, “The Lord has blessed the household of . Obed. -Edom and everything he has, because of the ark of God.” So David went to bring up the ark of God from the house of . Obed. Amplification. Primer. Sequence (5’. . 3’). jlpPHI. /VIP. Partial . clone. jlpVIP-F1. CACTCGGACGCGGTGTTCAC. jlpVIP-R1. GGACAGAATGGACTTGGCGT. 5’RACE (1st round). AAP. GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGII. 1 Samuel 2. 27 . Now a man of God came to Eli and said to him, ‘This is what the Lord says: “Did I not clearly reveal myself to your ancestor’s family when they were in Egypt under Pharaoh? . Backgammon 1st and 2nd Moves1. The first move listed is what I use for the first and second move, unless the red second move states otherwise.2. I do not list detail W, G, BG, L, LG, LBG, and equity st. & 2. nd. Great Awakenings. 1. st - . 1730-1750. NE primarily. Spontaneous groups. George Whitefield. Jonathan Edwards, . Sinners in the Hands of an Angry God. Significance: 1. st. mass movement in colonies – helped prepare them for independence movement. The Lord said to Samuel, “How long will you grieve over Saul, since I have rejected him from being king over Israel? Fill your horn with oil, and go. I will send you to Jesse the . Bethlehemite. , for I have provided for myself a king among his sons.” . Blue Level Questions. What were the people of Israel to do to return to the Lord with all their hearts? (7:3). Get rid of the foreign gods and . Ashtoreths. Commit themselves to the Lord. Serve the Lord only. I g. ave . y. ou. …. I made you King. Then Nathan said to David, “You are the man! Thus says the Lord God of Israel: ‘I anointed you king over . Israel…. 2 . Samuel . 12:7a. I delivered you from Saul and . Amalek. , and utterly destroy all that they have, and do not spare them. But kill both man and woman, infant and nursing child, ox and sheep, camel and donkey.'" (NKJV). “Bleating Sheep & Lowing Oxen”. K St H St M St R St 4th St L St 1st St 5th St 3rd St P St 6th St F St I St 2nd St New York Ave Q St N St O St G St New Jersey Ave Quincy Pl Bates St Interstate 395 North Capitol St G Pl Massachusetts DEPARTMENT OF PHYSICAL . EDUCATION. ACHIVEMENTS 2015-16. St.Thomas College Awarded the . Second . Best College Among the Affiliated Colleges in Sports During the Year . 2015-16 . for the Overall Performance . Q = 4 + 15X – 7X. 2. 1. st. : . dQ. /. dX. = 15 – 14X. 2. nd. : d. 2. Q/dX. 2 . = – 14. p. = 2(5 – X – 3X. 2. ) – 8X – 15. 1. st. : . d. p. /. dX. = 2(– 1 – 6X) – 8 = – 10 – 12X.

Download Document

Here is the link to download the presentation.
"1st & 2nd Samuel"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents