PPT-What’s New in FlyBase

Author : min-jolicoeur | Published Date : 2016-08-09

EDRC 2015 Heidelberg Visualising interaction networks Visualising interaction networks Physical interactions Visualising interaction networks Genetic interactions

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "What’s New in FlyBase" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

What’s New in FlyBase: Transcript


EDRC 2015 Heidelberg Visualising interaction networks Visualising interaction networks Physical interactions Visualising interaction networks Genetic interactions Collaboration with esyN wwwesynorg. Drosophila. An introduction to web tools, databases and NCBI BLAST. Wilson Leung . 08/2016. Agenda. GEP annotation project overview. Web databases for . Drosophila. annotation. UCSC Genome Browser. An introduction to web tools, . databases, and NCBI BLAST. Wilson Leung 12/2021. Agenda. GEP annotation project overview. Web databases for . Drosophila. annotation. UCSC Genome Browser. NCBI / BLAST. 2606 frame (ORF) was cloned into the I site of pAc5.1/c-MYC-HISAusing the following PCR primers: AcCYLD-F: 5-CCCGAATTCC A -AAATGATCTTAAACAACAA AAG TAAAAC-3CCCCTCGAGATGGTACATCATTA TATCTGTGC-3MYC-HIS A The Benefits of Reading Books,Most people read to read and the benefits of reading are surplus. But what are the benefits of reading. Keep reading to find out how reading will help you and may even add years to your life!.The Benefits of Reading Books,What are the benefits of reading you ask? Down below we have listed some of the most common benefits and ones that you will definitely enjoy along with the new adventures provided by the novel you choose to read.,Exercise the Brain by Reading .When you read, your brain gets a workout. You have to remember the various characters, settings, plots and retain that information throughout the book. Your brain is doing a lot of work and you don’t even realize it. Which makes it the perfect exercise! Drosophila . Nep1, Nepl15, . Ey. , . Ctb. and. Tobi from flybase.org database.. . Nep1: . Neprilysin. 1. Nepl15: . Neprilysin. like 15. Ey. : Eyeless. Ctp. : Cut up: Tobi: target of . brain insulin.

Download Document

Here is the link to download the presentation.
"What’s New in FlyBase"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents