Upload
Featured Recent Articles Topics Login Upload

Search Results for ''

published presentations and documents on DocSlides.

The neutral model approach
The neutral model approach
by calandra-battersby
Stephen P. . Hubbell. (1942-. Motoo. . Kimura. ...
competition of plant species
competition of plant species
by conchita-marotz
Competition between species. The struggle for foo...
Species-Neutral vs. Multi-Species Ontologies
Species-Neutral vs. Multi-Species Ontologies
by conchita-marotz
Barry Smith. New York Times response. US DoD Civi...
Optimizing Nutrient Concentration Levels in Media and Feed Formulations
Optimizing Nutrient Concentration Levels in Media and Feed Formulations
by rodriguez
November 19th, 2019. Marc Donohue, Alan Stone, Mic...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Ecological communities
Ecological communities
by tatyana-admore
A . community . is a local . assembly . of speci...
IMPRS workshop
IMPRS workshop
by alexa-scheidler
Comparative Genomics. 18. th. -21. st. of Februa...
Motoo Kimura 1968 Neutral Theory
Motoo Kimura 1968 Neutral Theory
by bella
Genetic Drift is main force for changing allele fr...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by luanne-stotts
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...