PPT-Non-isotopic labeling Use of non-radioactive probes

Two types of nonradioactive labeling are performed direct or indirect Direct Probes that are directly conjugated to a dye or an enzyme which generates the detection signal Often such system involve incorporation of modified nucleotide containing a chemical group which can fluoresce when exposed to light of a certain wavelength . Rajesh Agnihotri. 1*. , S.G. Karapurkar. 2. , V.V.S.S. Sarma. 3. , P. Praveen. 3. , M.D. . Dileep. Kumar. 2.  . 1. CSIR-National Physical Laboratory, New Delhi, 110012, India, . 2. CSIR-National Institute of Oceanography, Dona Paula Goa 403004, India, . Kristina . Melnik. & Stephanie . Felten. University of Utah. Isotopic Labeling. References: . http://en.wikipedia.org/wiki/Isotopic_labeling. , . http://en.wikipedia.org/wiki/Crossover_experiment_%. 3. N in the massive star-forming region Sgr B2(M). Takahiro Oyama. , Rin Abe, Ayane Miyazaki, . Mitsunori Araki, Shuro Takano, Nobuhiko Kuze,. Yoshihiro Sumiyoshi, and Koichi Tsukiyama. ・. Isotopic ratios of HC. Kamana. Yadav. 1*. , Rajesh Agnihotri. 2. , Vedula .V.S. Sarma. 3. , Supriya G. Karapurkar. 1. , Praveen Kumar Poosarla. 3. , M. Dileep Kumar. 1. 1.CSIR- Chemical Oceanography Division, National Institute of Oceanography, Goa, India.. Lecture . 9. Absolute Dating of the Earth. Major Concepts. The discovery of radioactivity in the early 1900’s and the recognition that . radioactive deca. y . (a statistical event) . occurs at a constant average rate for particular unstable isotopes has provided a means of determining the absolute ages of earth materials. Lecture 9. Absolute Dating of the Earth. Major Concepts. The discovery of radioactivity in the early 1900’s and the recognition that . radioactive decay . (a statistical event) occurs at a constant average rate for particular unstable isotopes has provided a means of determining the absolute ages of earth materials. FIGURE 01: Simple Bohr-type model of a lithium atom. Radioactive Isotopes. Unstable isotopes decay to other nuclides. The rate of decay is constant, and not affected by P, T, X…. Parent. nuclide = . VBC-321. Animal Biotechnology. A . probe. is a nucleic acid which has been . labeled. i.e., chemically modified in some way which allows it and hence anything it hybridizes to, to be detected.. There are three major types of probe: . Melnik. & Stephanie . Felten. University of Utah. Isotopic Labeling. References: . http://en.wikipedia.org/wiki/Isotopic_labeling. , . http://en.wikipedia.org/wiki/Crossover_experiment_%. 28chemistry%29. Hapten-modied Nucleotides for ACCCACGAAAGGGAAATAAGCAACOTTCAGGGAAGAACTAUAACTGCCACACCCACGAAAGGGAAATAAGCAACOTTCAGGGAAGAA CTAUAACTGCCAC ACCCACGAAAGGGAA ATAAGC AACO TTCAGGGAAGAACTAUAACTGCCACACCCACGAA becquerel. (. Bq. ), in honor of the scientist Henri Becquerel. One . Bq. is defined as one transformation, decay, or disintegration per second. Since sensible sizes of radioactive material contain many atoms, a . Rate of Radioactive decay with units. Geiger-Muller Counter. An atom is composed of positively charged nucleus that is surrounded by. negatively charged electrons.. The number of electrons is equal to the number of protons = Atomic Number. Rate of Radioactive decay with units. Geiger-Muller Counter. An atom is composed of positively charged nucleus that is surrounded by. negatively charged electrons.. The number of electrons is equal to the number of protons = Atomic Number. Biology. Shane . Lamos. Vermont Genetics Network Annual Retreat. August 7, 2013. 1. Systems Biology -. 2. Seeks to discover the link between molecules and physiology . Top Down – “. omics. ”, phenomenon based.