PPT-Non-isotopic labeling Use of non-radioactive probes

Author : skylar | Published Date : 2023-06-10

Two types of nonradioactive labeling are performed direct or indirect Direct Probes that are directly conjugated to a dye or an enzyme which generates the detection

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Non-isotopic labeling Use of non-radioac..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Non-isotopic labeling Use of non-radioactive probes: Transcript


Two types of nonradioactive labeling are performed direct or indirect Direct Probes that are directly conjugated to a dye or an enzyme which generates the detection signal Often such system involve incorporation of modified nucleotide containing a chemical group which can fluoresce when exposed to light of a certain wavelength . Rajesh Agnihotri. 1*. , S.G. Karapurkar. 2. , V.V.S.S. Sarma. 3. , P. Praveen. 3. , M.D. . Dileep. Kumar. 2.  . 1. CSIR-National Physical Laboratory, New Delhi, 110012, India, . 2. CSIR-National Institute of Oceanography, Dona Paula Goa 403004, India, . Kristina . Melnik. & Stephanie . Felten. University of Utah. Isotopic Labeling. References: . http://en.wikipedia.org/wiki/Isotopic_labeling. , . http://en.wikipedia.org/wiki/Crossover_experiment_%. 3. N in the massive star-forming region Sgr B2(M). Takahiro Oyama. , Rin Abe, Ayane Miyazaki, . Mitsunori Araki, Shuro Takano, Nobuhiko Kuze,. Yoshihiro Sumiyoshi, and Koichi Tsukiyama. ・. Isotopic ratios of HC. Kamana. Yadav. 1*. , Rajesh Agnihotri. 2. , Vedula .V.S. Sarma. 3. , Supriya G. Karapurkar. 1. , Praveen Kumar Poosarla. 3. , M. Dileep Kumar. 1. 1.CSIR- Chemical Oceanography Division, National Institute of Oceanography, Goa, India.. Lecture . 9. Absolute Dating of the Earth. Major Concepts. The discovery of radioactivity in the early 1900’s and the recognition that . radioactive deca. y . (a statistical event) . occurs at a constant average rate for particular unstable isotopes has provided a means of determining the absolute ages of earth materials. Lecture 9. Absolute Dating of the Earth. Major Concepts. The discovery of radioactivity in the early 1900’s and the recognition that . radioactive decay . (a statistical event) occurs at a constant average rate for particular unstable isotopes has provided a means of determining the absolute ages of earth materials. FIGURE 01: Simple Bohr-type model of a lithium atom. Radioactive Isotopes. Unstable isotopes decay to other nuclides. The rate of decay is constant, and not affected by P, T, X…. Parent. nuclide = . VBC-321. Animal Biotechnology. A . probe. is a nucleic acid which has been . labeled. i.e., chemically modified in some way which allows it and hence anything it hybridizes to, to be detected.. There are three major types of probe: . Melnik. & Stephanie . Felten. University of Utah. Isotopic Labeling. References: . http://en.wikipedia.org/wiki/Isotopic_labeling. , . http://en.wikipedia.org/wiki/Crossover_experiment_%. 28chemistry%29. Hapten-modied Nucleotides for ACCCACGAAAGGGAAATAAGCAACOTTCAGGGAAGAACTAUAACTGCCACACCCACGAAAGGGAAATAAGCAACOTTCAGGGAAGAA CTAUAACTGCCAC ACCCACGAAAGGGAA ATAAGC AACO TTCAGGGAAGAACTAUAACTGCCACACCCACGAA becquerel. (. Bq. ), in honor of the scientist Henri Becquerel. One . Bq. is defined as one transformation, decay, or disintegration per second. Since sensible sizes of radioactive material contain many atoms, a . Rate of Radioactive decay with units. Geiger-Muller Counter. An atom is composed of positively charged nucleus that is surrounded by. negatively charged electrons.. The number of electrons is equal to the number of protons = Atomic Number. Rate of Radioactive decay with units. Geiger-Muller Counter. An atom is composed of positively charged nucleus that is surrounded by. negatively charged electrons.. The number of electrons is equal to the number of protons = Atomic Number. Biology. Shane . Lamos. Vermont Genetics Network Annual Retreat. August 7, 2013. 1. Systems Biology -. 2. Seeks to discover the link between molecules and physiology . Top Down – “. omics. ”, phenomenon based.

Download Document

Here is the link to download the presentation.
"Non-isotopic labeling Use of non-radioactive probes"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents