Name and Degree(s)

Download presentation
1 - 20

teresa's Recent Documents

National Institute on Drug AbuseNational Institutes of Health
National Institute on Drug AbuseNational Institutes of Health

1 MarijuanaTeensFacts 12 Did you know that teen marijuana use has dropped dramatically since the late 1990s? So

published 1K
Vol10No10REBIaYeastDNABindingProteinwithManyTargetsIsEssentialfo
Vol10No10REBIaYeastDNABindingProteinwithManyTargetsIsEssentialfo

CLONINGOFYEASTREB15227ofeachoftwocomplementaryoligonucleotides,JW107andJW106JW107GATCTACTGGGTTACCCGGGGCACCTGJW106ATGACCCAATGGGCCCCGTGGACCTAGwereseparatelyphosphorylatedwith[-y-32P]ATPbyusingpolynucleo

published 1K
Heated swimming pool
Heated swimming pool

Air conditioning Sea view Central heating Wood burning stove Dining room Utility room Electric shutters South Facing Near shops Energy rating: A Year built 2017 Borehole water Possibility

published 1K
PATIENTINFORMATIONCOVID19
PATIENTINFORMATIONCOVID19

STAY HOME. STAY CALM. CALL CANO. 855.CANO.MED (855.226.6633)Patient ComunicationDue to increased call volume from an overwhelming need for our services, response times may than usual at our call cent

published 1K
Now Zebo is smiling She gained hope for the future But there was a t
Now Zebo is smiling She gained hope for the future But there was a t

In 1995, Zebo small kids after a divorce. She got employed in the café first as dishcleaner and then started to help on the kitchenas an assistant to chef. She had a special taste and talent for ma

published 1K
Homeowners
Homeowners

Association Newsletter August/September 2011 — www.harveyoaks.com THE ANNUAL HARVEY OAKS PICNIC IS FINALLY HERE!! SATURDAY AUGUST 20 TH 3 - 7 PM IN THE NORTH PARK (BY THE TENNIS COURTS) Lots

published 1K
Dyreassisterte
Dyreassisterte

intervensjoner med hund Norges miljø- og biovitenskapelige universitet Seksjon for folkehelse, ILP Senter for etter- og videreutdanning 1. samling:17. 19. oktober 2016 2. samling:12.  14. d

published 1K
Download Section

Download - The PPT/PDF document "" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.






Document on Subject : "Name and Degree(s)"— Transcript:

1 Name and Degree(s) Professor Errico Zu
Name and Degree(s) Professor Errico Zupi Current Position or Job Title Associate Professor of Ob/Gyn Univerity of Tor Vergata Rome Italy Hospital of Affiliation Policlinico Tor Vergata City, Country Rome Official Email Address ezupi@libero.it Biography (100 - word) Associate Professor starting from 2005 at the University of Rome “Tor Vergata” department of Obstetrics and Gynecology. Associate Professor starting from 2012 to 2015 at the University of Siena, Department of Molecular Medicine section of Obstetrics and Gynecology. Associate Professor starting from 2015 at the University of Tor Vergata Rome, Department of Biomedicine and Pr evention section of Obstetrics and Gynecology. Appointed as Full Professor of Obstetrics and Gynecology on January 2014 h - index 35 Author of 195 publications of which 137 published in international peer reviewed journals Editor of 4 book Author of 24 cha pters edited in 12 volumes Picture