PPT-First Questions for Algorithm Analysis

Author : test | Published Date : 2018-11-18

What is an algorithm From the text p 3 An algorithm is a sequence of unambiguous instructions for solving a problem ie for obtaining a required output for any legitimate

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "First Questions for Algorithm Analysis" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

First Questions for Algorithm Analysis: Transcript

What is an algorithm From the text p 3 An algorithm is a sequence of unambiguous instructions for solving a problem ie for obtaining a required output for any legitimate input in a finite amount of time. and Shavit-Francez termination algorithms. Index :. Introduction. Experimental Setup. Result Analysis. Conclusion. Future Work. Introduction. Dijkstra-Scholten. algorithm detects the termination of a centralized basic computation.. B. . Steensgaard: . Points-to Analysis in Almost Linear Time. .. POPL 1996. M. Hind. : . Pointer analysis: haven't we solved this problem yet. ?. . PASTE 2001. Presented by Ronnie . Barequet. 23.03.14. The purpose of factor analysis is to discover patterns in the relationships among the . variables. Factor Analysis. Form of multiple correlations. Checking for construct validity. Do questions measure the same dimension?. A computer algorithm is. a detailed step-by-step method for. solving a problem. by using a computer.. Problem-Solving (Science and Engineering). Analysis. How does it work?. Breaking a system down to known components. Annotation Activities For each . R. eading . S. ection:. 1.Define key vocabulary with context.. 2. Ask at least 2 how or why questions?. 3. Answer the 2 required questions.. 4. State the main ideas of the entire section in a complete thought.. Algorithm. Input. Output. 1. Analysis of Algorithms. How long does this take to open 1) know 2) don’t know. . Analysis of Algorithms. 2. If know combination O(n) . where n is number of rings. . If the alphabet is size m, O(nm). 0010010010. 1001011100. 01010000110000101001. 1001011011. 0010100100. 00100100101. 10001010011. 10001010011010. ataacgtagcacatagtagtccagtagctgatcgtagaactgcatgatccaagctgctgatacgatgaacacctgagatgctgatgctgatagctagtcg. Focus: developing algorithms . abstractly. Independent of programming . language, data types, etc.. Think of a stack or queue: not specific to C , but can be implemented when needed. Addressed in depth during COSC 320. Domenico Giordano, Andrea Valassi. . (CERN IT-SDC). With contributions from and many thanks to Hassen Riahi . White Area Lecture, 3. rd. June 2015. . (Follow-up to the previous . White Area Lecture on 18. Spring . 2018. Analyzing problems. interesting problem: residence matching. lower bounds on problems. decision trees, adversary arguments, problem . reduction. I. nteresting problem: residence matching. Today’s Lecture. Algorithm . Analysis. Asymptotic analysis. bigO. notation. Project 1. Checkpoint 1 due at 11:30 pm. Submit only the files listed in the deliverables section. If you submit as a group, make sure all files have both team names. Assorted minutiae. HW1P1 due tonight at midnight. HW1P2 due Friday at midnight. HW2 out tonight. Second Java review session: . Friday 10:30 – ARC 147. Today’s Schedu. le. Algorithm Analysis, cont.. Objectives. Determine the running time of simple algorithms. Best case. Average case. Worst case. Profile algorithms. Understand O notation's mathematical basis. Use O notation to measure running time. for Algorithm Analysis Topics. Mohammed . Farghally. Information Systems Department, . Assiut. University, Egypt. Kyu. Han . Koh. Department of Computer Science, CSU . Stanislaus. Jeremy V. Ernst. School of Education, Virginia Tech.

Download Document

Here is the link to download the presentation.
"First Questions for Algorithm Analysis"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.