PPT-1st & 2nd Samuel
Author : trish-goza | Published Date : 2017-04-28
Dig Site 11 Blue Level Questions Who drew up the battle line to meet the Philistines 172 The Amalekites Samuel and the priests Saul and the Israelites The Amorites
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "1st & 2nd Samuel" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
1st & 2nd Samuel: Transcript
Dig Site 11 Blue Level Questions Who drew up the battle line to meet the Philistines 172 The Amalekites Samuel and the priests Saul and the Israelites The Amorites and priests Who drew up the battle line to meet the Philistines 172. Samuel 289 WTT 1 Samuel 28 WTT 1 Samuel 29 BHT 1 S uel 28 BHT 1 S uel 29 XT 1 S muel 28 XT 1 S muel 29 XE 1 S muel 28 He l fts up the poor fro he earth nd raises he nee fr he dunghi l to seat h th he prince And Saul and the men of Israel were gathered, and encamped in the Valley of . Elah. , and drew up in line of battle against the Philistines. . 3 . And the Philistines stood on the mountain on the one side, and Israel stood on the mountain on the other side, with a valley between them. . Now . King David was told, “The Lord has blessed the household of . Obed. -Edom and everything he has, because of the ark of God.” So David went to bring up the ark of God from the house of . Obed. Amplification. Primer. Sequence (5’. . 3’). jlpPHI. /VIP. Partial . clone. jlpVIP-F1. CACTCGGACGCGGTGTTCAC. jlpVIP-R1. GGACAGAATGGACTTGGCGT. 5’RACE (1st round). AAP. GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGII. 1 Samuel 2. 27 . Now a man of God came to Eli and said to him, ‘This is what the Lord says: “Did I not clearly reveal myself to your ancestor’s family when they were in Egypt under Pharaoh? . As a Boy. 1. 1 Samuel 1:21-23 . 21 . Then the man . Elkanah. went up with all his household to offer to the . Lord. the yearly sacrifice and . pay. his vow. . 22 . But Hannah did not go up, for she said to her husband, “. st. & 2. nd. Great Awakenings. 1. st - . 1730-1750. NE primarily. Spontaneous groups. George Whitefield. Jonathan Edwards, . Sinners in the Hands of an Angry God. Significance: 1. st. mass movement in colonies – helped prepare them for independence movement. Woods Runner Literary Elements and Review. 2. Setting. The setting is Colonial America at war, and this takes place in the late 1700s. This is what it looked like in some places during the American Revolution.. 1 Samuel 7. 9 months of struggle. Watch out that God’s truth. is not twisted. 2 Peter 3:11-18. Be Holy!. Do you take that seriously?. Holiness is:. Being Separate. Holiness is:. Being Separate. Not taking part in sin. Divine wrath. 21. 22. David's psalm. David's last song . 23. 24. Divine wrath. David's warriors. David's warriors. How God saved the day for David. Why God saved the day for David. What God enabled David to do to help save the day. Blue Level Questions. What were the people of Israel to do to return to the Lord with all their hearts? (7:3). Get rid of the foreign gods and . Ashtoreths. Commit themselves to the Lord. Serve the Lord only. Jonathan had . Heroic . F. aith . Then Jonathan said to the young man who bore his armor, “Come, let us go over to the garrison of these uncircumcised; it may be that the Lord will work for . us.. 1 . I g. ave . y. ou. …. I made you King. Then Nathan said to David, “You are the man! Thus says the Lord God of Israel: ‘I anointed you king over . Israel…. 2 . Samuel . 12:7a. I delivered you from Saul and . Billings, WEWIDec 7-0Billings, WEWIBillings, WEWI451Price, FORBPrice, FORB344Kelly, NOJAKeaten Silva (2A-W 1st)MAID, 36-11, 10Silva, MAIDBillings, WEWIDerby, FIFLDerby, FIFLDec 4-2507Mat 9397Mat 9Naiy
Download Document
Here is the link to download the presentation.
"1st & 2nd Samuel"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents